EMAIL THIS PAGE TO A FRIEND

FCRL2

Fc receptor-like 2

52 Gene Product Result for
Synonyms: CD307b FCRH2 IFGP4 IRTA4 SPAP1 SPAP1A SPAP1B SPAP1C
Gene ID:
Human(79368) Summary: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein has four extracellular C2-type immunoglobulin domains, a transmembrane domain and a cytoplasmic domain that contains one immunoreceptor-tyrosine activation motif and two immunoreceptor-tyrosine inhibitory motifs. This protein may be a prognostic marker for chronic lymphocytic leukemia. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Apr 2009]
Rat(310694) Fc receptor-like 2
chicken(425592) Fc receptor-like 2
dog(612038) Fc receptor-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1454 Human FCRL2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066541 MISSION® esiRNA esiRNA human FCRL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030764 Rosetta Predictions human pricing
NM_138738 Rosetta Predictions human pricing
NM_001107702 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129726 predicted 1317
2 SASI_Hs02_00358294 predicted 1307
3 SASI_Hs02_00358295 predicted 1226
4 SASI_Hs01_00129727 predicted 1363
5 SASI_Hs01_00129728 predicted 1486
6 SASI_Hs01_00129730 predicted 1366
7 SASI_Hs02_00358296 predicted 1274
8 SASI_Hs02_00358297 predicted 1353
9 SASI_Hs01_00129731 predicted 1323
10 SASI_Hs01_00129732 predicted 1502
11 SASI_Hs01_00129729 predicted 1285
12 SASI_Hs01_00129733 predicted 1501
13 SASI_Hs01_00129734 predicted 1261
14 SASI_Hs01_00129735 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363859 predicted 1104
2 SASI_Hs01_00014040 predicted 820
3 SASI_Hs02_00363860 predicted 801
4 SASI_Hs02_00363861 predicted 1054
5 SASI_Hs02_00363862 predicted 1172
6 SASI_Hs02_00363863 predicted 725
7 SASI_Hs02_00363864 predicted 1045
8 SASI_Hs01_00014041 predicted 862
9 SASI_Hs01_00014042 predicted 992
10 SASI_Hs01_00014044 predicted 868
11 SASI_Hs01_00014043 predicted 778
12 SASI_Hs01_00014045 predicted 823
13 SASI_Hs01_00014046 predicted 1005
14 SASI_Hs01_00014047 predicted 1001
15 SASI_Hs01_00014048 predicted 761
16 SASI_Hs01_00014049 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231435 predicted 373
2 SASI_Rn02_00231436 predicted 348
3 SASI_Rn02_00231437 predicted 1008
4 SASI_Rn02_00231438 predicted 540
5 SASI_Rn02_00231439 predicted 1352
6 SASI_Rn02_00231440 predicted 578
7 SASI_Rn02_00231441 predicted 323
8 SASI_Rn02_00231442 predicted 1749
9 SASI_Rn02_00231443 predicted 1631
10 SASI_Rn02_00231444 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030764
FCRL2 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-446s1c1
Sequence:CCGGCCACAGAGGTTGGATGTTCAACTCGAGTTGAACATCCAACCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-898s1c1
Sequence:CCGGCCAGAGCAAGGTGGTGAATATCTCGAGATATTCACCACCTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-194s1c1
Sequence:CCGGGCTTACCATAAGGATAACAAACTCGAGTTTGTTATCCTTATGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-303s1c1
Sequence:CCGGGACAACTCTTTCTCTGGGATACTCGAGTATCCCAGAGAAAGAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-1492s1c1
Sequence:CCGGGCCAGAAAGCTCAGCAAACATCTCGAGATGTTTGCTGAGCTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030764.3-1920s21c1
Sequence:CCGGGGACTTGATAGTGGTGTATTACTCGAGTAATACACCACTATCAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030764.3-280s21c1
Sequence:CCGGTAAGTGACAGTGGTAACTATTCTCGAGAATAGTTACCACTGTCACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030764
FCRL2 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-446s1c1
Sequence:CCGGCCACAGAGGTTGGATGTTCAACTCGAGTTGAACATCCAACCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-898s1c1
Sequence:CCGGCCAGAGCAAGGTGGTGAATATCTCGAGATATTCACCACCTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-194s1c1
Sequence:CCGGGCTTACCATAAGGATAACAAACTCGAGTTTGTTATCCTTATGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-303s1c1
Sequence:CCGGGACAACTCTTTCTCTGGGATACTCGAGTATCCCAGAGAAAGAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-1492s1c1
Sequence:CCGGGCCAGAAAGCTCAGCAAACATCTCGAGATGTTTGCTGAGCTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030764.3-1920s21c1
Sequence:CCGGGGACTTGATAGTGGTGTATTACTCGAGTAATACACCACTATCAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030764.3-280s21c1
Sequence:CCGGTAAGTGACAGTGGTAACTATTCTCGAGAATAGTTACCACTGTCACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030764
FCRL2 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-446s1c1
Sequence:CCGGCCACAGAGGTTGGATGTTCAACTCGAGTTGAACATCCAACCTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-898s1c1
Sequence:CCGGCCAGAGCAAGGTGGTGAATATCTCGAGATATTCACCACCTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-194s1c1
Sequence:CCGGGCTTACCATAAGGATAACAAACTCGAGTTTGTTATCCTTATGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-303s1c1
Sequence:CCGGGACAACTCTTTCTCTGGGATACTCGAGTATCCCAGAGAAAGAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030764.2-1492s1c1
Sequence:CCGGGCCAGAAAGCTCAGCAAACATCTCGAGATGTTTGCTGAGCTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030764.3-1920s21c1
Sequence:CCGGGGACTTGATAGTGGTGTATTACTCGAGTAATACACCACTATCAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030764.3-280s21c1
Sequence:CCGGTAAGTGACAGTGGTAACTATTCTCGAGAATAGTTACCACTGTCACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)