EMAIL THIS PAGE TO A FRIEND

FCRL3

Fc receptor-like 3

99 Gene Product Result for
Synonyms: CD307c FCRH3 IFGP3 IRTA3 SPAP2
Gene ID:
Human(115352) Summary: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains immunoreceptor-tyrosine activation motifs and immunoreceptor-tyrosine inhibitory motifs in its cytoplasmic domain and may play a role in regulation of the immune system. Mutations in this gene have been associated with rheumatoid arthritis, autoimmune thyroid disease, and systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
Rat(680697) Fc receptor-like 3
domestic guinea pig(100729440) Fc receptor-like 3
sheep(101112874) Fc receptor-like 3
dog(612046) Fc receptor-like 3
cow(515085) Fc receptor-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1455 Human FCRL3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052939 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084341 MISSION® esiRNA esiRNA human FCRL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024667 Rosetta Predictions human pricing
NM_052939 Rosetta Predictions human pricing
XM_001058446 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192698 predicted 421
2 SASI_Hs01_00192699 predicted 2322
3 SASI_Hs01_00192700 predicted 1262
4 SASI_Hs01_00192701 predicted 1276
5 SASI_Hs01_00192702 predicted 952
6 SASI_Hs01_00192703 predicted 2314
7 SASI_Hs01_00192704 predicted 425
8 SASI_Hs01_00192705 predicted 506
9 SASI_Hs01_00192706 predicted 734
10 SASI_Hs01_00192707 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026287 predicted 413
2 SASI_Hs01_00026288 predicted 2310
3 SASI_Hs01_00026290 predicted 1267
4 SASI_Hs01_00026291 predicted 945
5 SASI_Hs01_00026292 predicted 2312
6 SASI_Hs01_00026293 predicted 424
7 SASI_Hs01_00026294 predicted 501
8 SASI_Hs01_00026295 predicted 721
9 SASI_Hs01_00026296 predicted 773
10 SASI_Hs02_00361725 predicted 730
11 SASI_Hs01_00026289 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289762 predicted 1207
2 SASI_Rn02_00289763 predicted 445
3 SASI_Rn02_00289764 predicted 221
4 SASI_Rn02_00289765 predicted 1690
5 SASI_Rn02_00289766 predicted 975
6 SASI_Rn02_00289767 predicted 559
7 SASI_Rn02_00289768 predicted 432
8 SASI_Rn02_00289769 predicted 466
9 SASI_Rn02_00289770 predicted 1445
10 SASI_Rn02_00289771 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052939
FCRL3 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052939.3-2752s21c1
Sequence:CCGGAGCTCCTAGGGCTGTCGAATACTCGAGTATTCGACAGCCCTAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052939.3-2694s21c1
Sequence:CCGGTGAGCAAGCACTGTGTTATTTCTCGAGAAATAACACAGTGCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-2244s1c1
Sequence:CCGGGCAATGTAAATCCTGGAGATACTCGAGTATCTCCAGGATTTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-617s1c1
Sequence:CCGGCCTGTCTTTGAAGGAGACAATCTCGAGATTGTCTCCTTCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-754s1c1
Sequence:CCGGCTCCAGGGATAATAGCAAATACTCGAGTATTTGCTATTATCCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-1968s1c1
Sequence:CCGGCACTCAATGTTACAGGAACTTCTCGAGAAGTTCCTGTAACATTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052939
FCRL3 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052939.3-2752s21c1
Sequence:CCGGAGCTCCTAGGGCTGTCGAATACTCGAGTATTCGACAGCCCTAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052939.3-2694s21c1
Sequence:CCGGTGAGCAAGCACTGTGTTATTTCTCGAGAAATAACACAGTGCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-2244s1c1
Sequence:CCGGGCAATGTAAATCCTGGAGATACTCGAGTATCTCCAGGATTTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-617s1c1
Sequence:CCGGCCTGTCTTTGAAGGAGACAATCTCGAGATTGTCTCCTTCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-754s1c1
Sequence:CCGGCTCCAGGGATAATAGCAAATACTCGAGTATTTGCTATTATCCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-1968s1c1
Sequence:CCGGCACTCAATGTTACAGGAACTTCTCGAGAAGTTCCTGTAACATTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052939
FCRL3 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052939.3-2752s21c1
Sequence:CCGGAGCTCCTAGGGCTGTCGAATACTCGAGTATTCGACAGCCCTAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052939.3-2694s21c1
Sequence:CCGGTGAGCAAGCACTGTGTTATTTCTCGAGAAATAACACAGTGCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-2244s1c1
Sequence:CCGGGCAATGTAAATCCTGGAGATACTCGAGTATCTCCAGGATTTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-617s1c1
Sequence:CCGGCCTGTCTTTGAAGGAGACAATCTCGAGATTGTCTCCTTCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-754s1c1
Sequence:CCGGCTCCAGGGATAATAGCAAATACTCGAGTATTTGCTATTATCCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052939.2-1968s1c1
Sequence:CCGGCACTCAATGTTACAGGAACTTCTCGAGAAGTTCCTGTAACATTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks