EMAIL THIS PAGE TO A FRIEND

FCRL4

Fc receptor-like 4

72 Gene Product Result for
Synonyms: CD307d FCRH4 IGFP2 IRTA1
UniProtKB ID: Q96PJ5, Q96PJ3, Q96RE0
Gene ID:
Human(83417) Summary: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein has four extracellular C2-type immunoglobulin domains, a transmembrane domain and a cytoplasmic domain that contains three immune-receptor tyrosine-based inhibitory motifs. This protein may play a role in the function of memory B-cells in the epithelia. Aberrations in the chromosomal region encoding this gene are associated with non-Hodgkin lymphoma and multiple myeloma. [provided by RefSeq, Apr 2009]
domestic cat(101080355) Fc receptor-like 4
cow(534753) Fc receptor-like 4
Horse(100053969) Fc receptor-like 4
dog(490400) Fc receptor-like 4
sheep(101112622) Fc receptor-like 4
naked mole-rat(101710383) Fc receptor-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031282 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129301 MISSION® esiRNA esiRNA human FCRL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031282 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086990 predicted 646
2 SASI_Hs01_00086991 predicted 1475
3 SASI_Hs01_00086992 predicted 261
4 SASI_Hs01_00086993 predicted 597
5 SASI_Hs02_00358704 predicted 582
6 SASI_Hs01_00086994 predicted 1632
7 SASI_Hs01_00086995 predicted 1765
8 SASI_Hs01_00086997 predicted 1646
9 SASI_Hs02_00358705 predicted 1389
10 SASI_Hs02_00358706 predicted 623
11 SASI_Hs01_00086996 predicted 273
12 SASI_Hs01_00086998 predicted 1782
13 SASI_Hs01_00086999 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031282
FCRL4 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-533s1c1
Sequence:CCGGGCTGTGAAATATACTTGGAATCTCGAGATTCCAAGTATATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-191s1c1
Sequence:CCGGGCTGCACACAAACCTGTGATTCTCGAGAATCACAGGTTTGTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-1478s1c1
Sequence:CCGGCAGTCGTTGTATGTTGATGTACTCGAGTACATCAACATACAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-909s1c1
Sequence:CCGGCCTATTGGTGTGGTGCTGAAACTCGAGTTTCAGCACCACACCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-1636s1c1
Sequence:CCGGCCCAGATAACTCAGCTGGAAACTCGAGTTTCCAGCTGAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031282.2-1910s21c1
Sequence:CCGGAGAGAAGACCCTGTAGTATTTCTCGAGAAATACTACAGGGTCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031282.2-1705s21c1
Sequence:CCGGACGTCCTACTCATGTGATTTCCTCGAGGAAATCACATGAGTAGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031282.2-612s21c1
Sequence:CCGGCAAATAACAATGGCAATTATCCTCGAGGATAATTGCCATTGTTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031282
FCRL4 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-533s1c1
Sequence:CCGGGCTGTGAAATATACTTGGAATCTCGAGATTCCAAGTATATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-191s1c1
Sequence:CCGGGCTGCACACAAACCTGTGATTCTCGAGAATCACAGGTTTGTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-1478s1c1
Sequence:CCGGCAGTCGTTGTATGTTGATGTACTCGAGTACATCAACATACAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-909s1c1
Sequence:CCGGCCTATTGGTGTGGTGCTGAAACTCGAGTTTCAGCACCACACCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-1636s1c1
Sequence:CCGGCCCAGATAACTCAGCTGGAAACTCGAGTTTCCAGCTGAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031282.2-1910s21c1
Sequence:CCGGAGAGAAGACCCTGTAGTATTTCTCGAGAAATACTACAGGGTCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031282.2-1705s21c1
Sequence:CCGGACGTCCTACTCATGTGATTTCCTCGAGGAAATCACATGAGTAGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031282.2-612s21c1
Sequence:CCGGCAAATAACAATGGCAATTATCCTCGAGGATAATTGCCATTGTTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031282
FCRL4 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-533s1c1
Sequence:CCGGGCTGTGAAATATACTTGGAATCTCGAGATTCCAAGTATATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-191s1c1
Sequence:CCGGGCTGCACACAAACCTGTGATTCTCGAGAATCACAGGTTTGTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-1478s1c1
Sequence:CCGGCAGTCGTTGTATGTTGATGTACTCGAGTACATCAACATACAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-909s1c1
Sequence:CCGGCCTATTGGTGTGGTGCTGAAACTCGAGTTTCAGCACCACACCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031282.1-1636s1c1
Sequence:CCGGCCCAGATAACTCAGCTGGAAACTCGAGTTTCCAGCTGAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031282.2-1910s21c1
Sequence:CCGGAGAGAAGACCCTGTAGTATTTCTCGAGAAATACTACAGGGTCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031282.2-1705s21c1
Sequence:CCGGACGTCCTACTCATGTGATTTCCTCGAGGAAATCACATGAGTAGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031282.2-612s21c1
Sequence:CCGGCAAATAACAATGGCAATTATCCTCGAGGATAATTGCCATTGTTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks