EMAIL THIS PAGE TO A FRIEND

FCRL5

Fc receptor-like 5

138 Gene Product Result for
Synonyms: BXMAS1 CD307 CD307e FCRH5 IRTA2 PRO820
Gene ID:
Human(83416) Summary: This gene encodes a member of the immunoglobulin receptor superfamily and the Fc-receptor like family. This gene and several other Fc receptor-like gene members are clustered on the long arm of chromosome 1. The encoded protein is a single-pass type I membrane protein and contains 8 immunoglobulin-like C2-type domains. This gene is implicated in B cell development and lymphomagenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Mouse(329693) Fc receptor-like 5
naked mole-rat(101710737) Fc receptor-like 5
domestic guinea pig(100729158) Fc receptor-like 5
sheep(101112371) Fc receptor-like 5
dog(612055) Fc receptor-like 5
domestic cat(101080608) Fc receptor-like 5
cow(517126) Fc receptor-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1456 Human FCRL5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079291 MISSION® esiRNA esiRNA human FCRL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031281 Rosetta Predictions human pricing
NM_001113238 Rosetta Predictions mouse pricing
NM_183222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177389 predicted 1655
2 SASI_Hs01_00177391 predicted 2655
3 SASI_Hs01_00177390 predicted 1530
4 SASI_Hs02_00358701 predicted 2884
5 SASI_Hs01_00177393 predicted 535
6 SASI_Hs01_00177395 predicted 3182
7 SASI_Hs02_00358702 predicted 286
8 SASI_Hs01_00177397 predicted 1244
9 SASI_Hs01_00177398 predicted 1349
10 SASI_Hs02_00358703 predicted 916
11 SASI_Hs01_00177392 predicted 674
12 SASI_Hs01_00177394 predicted 1389
13 SASI_Hs01_00177396 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307293 predicted 413
2 SASI_Mm02_00307294 predicted 1263
3 SASI_Mm02_00307295 predicted 1326
4 SASI_Mm02_00307296 predicted 1109
5 SASI_Mm02_00307297 predicted 1074
6 SASI_Mm02_00307298 predicted 989
7 SASI_Mm02_00307299 predicted 1179
8 SASI_Mm02_00307300 predicted 1264
9 SASI_Mm02_00307301 predicted 704
10 SASI_Mm02_00307302 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350321 predicted 681
2 SASI_Mm01_00074240 predicted 1528
3 SASI_Mm01_00074241 predicted 1589
4 SASI_Mm01_00074244 predicted 1369
5 SASI_Mm01_00074246 predicted 1338
6 SASI_Mm02_00350322 predicted 1256
7 SASI_Mm02_00350323 predicted 1450
8 SASI_Mm02_00350324 predicted 1537
9 SASI_Mm02_00350325 predicted 971
10 SASI_Mm02_00350326 predicted 920
11 SASI_Mm01_00074239 predicted 563
12 SASI_Mm01_00074242 predicted 1733
13 SASI_Mm01_00074243 predicted 603
14 SASI_Mm01_00074245 predicted 268
15 SASI_Mm01_00074247 predicted 682
16 SASI_Mm01_00074248 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031281
FCRL5 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-648s21c1
Sequence:CCGGTATCGCTGTACTGGATATAAGCTCGAGCTTATATCCAGTACAGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-214s21c1
Sequence:CCGGGGACACCCAGGCCCATTATTTCTCGAGAAATAATGGGCCTGGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-949s21c1
Sequence:CCGGCAATGCCTTACAGCGTCATATCTCGAGATATGACGCTGTAAGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-1383s1c1
Sequence:CCGGCCCATCCTGTACCAGTTTCATCTCGAGATGAAACTGGTACAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-2083s1c1
Sequence:CCGGCCCAGCACAGTGACACAATATCTCGAGATATTGTGTCACTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-538s1c1
Sequence:CCGGCGGAAGTAACACTGAATAATACTCGAGTATTATTCAGTGTTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-2937s1c1
Sequence:CCGGGTACGGATCATCCAAGAGAAACTCGAGTTTCTCTTGGATGATCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-369s1c1
Sequence:CCGGCCAGACAATATCCTTGAGGTTCTCGAGAACCTCAAGGATATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031281
FCRL5 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-648s21c1
Sequence:CCGGTATCGCTGTACTGGATATAAGCTCGAGCTTATATCCAGTACAGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-214s21c1
Sequence:CCGGGGACACCCAGGCCCATTATTTCTCGAGAAATAATGGGCCTGGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-949s21c1
Sequence:CCGGCAATGCCTTACAGCGTCATATCTCGAGATATGACGCTGTAAGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-1383s1c1
Sequence:CCGGCCCATCCTGTACCAGTTTCATCTCGAGATGAAACTGGTACAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-2083s1c1
Sequence:CCGGCCCAGCACAGTGACACAATATCTCGAGATATTGTGTCACTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-538s1c1
Sequence:CCGGCGGAAGTAACACTGAATAATACTCGAGTATTATTCAGTGTTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-2937s1c1
Sequence:CCGGGTACGGATCATCCAAGAGAAACTCGAGTTTCTCTTGGATGATCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-369s1c1
Sequence:CCGGCCAGACAATATCCTTGAGGTTCTCGAGAACCTCAAGGATATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031281
FCRL5 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-648s21c1
Sequence:CCGGTATCGCTGTACTGGATATAAGCTCGAGCTTATATCCAGTACAGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-214s21c1
Sequence:CCGGGGACACCCAGGCCCATTATTTCTCGAGAAATAATGGGCCTGGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031281.2-949s21c1
Sequence:CCGGCAATGCCTTACAGCGTCATATCTCGAGATATGACGCTGTAAGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-1383s1c1
Sequence:CCGGCCCATCCTGTACCAGTTTCATCTCGAGATGAAACTGGTACAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-2083s1c1
Sequence:CCGGCCCAGCACAGTGACACAATATCTCGAGATATTGTGTCACTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-538s1c1
Sequence:CCGGCGGAAGTAACACTGAATAATACTCGAGTATTATTCAGTGTTACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-2937s1c1
Sequence:CCGGGTACGGATCATCCAAGAGAAACTCGAGTTTCTCTTGGATGATCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031281.1-369s1c1
Sequence:CCGGCCAGACAATATCCTTGAGGTTCTCGAGAACCTCAAGGATATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183222
FCRL5 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183222.2-1938s1c1
Sequence:CCGGCGTCAGTCTAATCTCACCGATCTCGAGATCGGTGAGATTAGACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1373s1c1
Sequence:CCGGTCTCCATGTATCCTGTATGAACTCGAGTTCATACAGGATACATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-595s1c1
Sequence:CCGGGCTCTCTATTCATCATGCAAACTCGAGTTTGCATGATGAATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1099s1c1
Sequence:CCGGCCTCAAATTCTCCTGGTATAACTCGAGTTATACCAGGAGAATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1028s1c1
Sequence:CCGGCCAGCCTCAAAGTTGGTGTTTCTCGAGAAACACCAACTTTGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183222
FCRL5 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183222.2-1938s1c1
Sequence:CCGGCGTCAGTCTAATCTCACCGATCTCGAGATCGGTGAGATTAGACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1373s1c1
Sequence:CCGGTCTCCATGTATCCTGTATGAACTCGAGTTCATACAGGATACATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-595s1c1
Sequence:CCGGGCTCTCTATTCATCATGCAAACTCGAGTTTGCATGATGAATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1099s1c1
Sequence:CCGGCCTCAAATTCTCCTGGTATAACTCGAGTTATACCAGGAGAATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1028s1c1
Sequence:CCGGCCAGCCTCAAAGTTGGTGTTTCTCGAGAAACACCAACTTTGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183222
FCRL5 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183222.2-1938s1c1
Sequence:CCGGCGTCAGTCTAATCTCACCGATCTCGAGATCGGTGAGATTAGACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1373s1c1
Sequence:CCGGTCTCCATGTATCCTGTATGAACTCGAGTTCATACAGGATACATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-595s1c1
Sequence:CCGGGCTCTCTATTCATCATGCAAACTCGAGTTTGCATGATGAATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1099s1c1
Sequence:CCGGCCTCAAATTCTCCTGGTATAACTCGAGTTATACCAGGAGAATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183222.2-1028s1c1
Sequence:CCGGCCAGCCTCAAAGTTGGTGTTTCTCGAGAAACACCAACTTTGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks