EMAIL THIS PAGE TO A FRIEND

FCRL6

Fc receptor-like 6

62 Gene Product Result for
Synonyms: FcRH6
UniProtKB ID: Q6DN72, A1KXW6, A2A4D6, Q6DN73, Q6XRC3, Q6ZNI1
Gene ID:
Mouse(677296) Fc receptor-like 6
Rat(305103) Fc receptor-like 6
cow(524565) Fc receptor-like 6
domestic cat(101092582) Fc receptor-like 6
dog(100684692) Fc receptor-like 6
sheep(101123087) Fc receptor-like 6
domestic guinea pig(100720417) Fc receptor-like 6
naked mole-rat(101703532) Fc receptor-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105576 Anti-FCRL6 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004310 Rosetta Predictions human pricing
XM_223121 Rosetta Predictions rat pricing
XM_001002083 Rosetta Predictions mouse pricing
XM_001477207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125132 predicted 309
2 SASI_Hs02_00304515 predicted 758
3 SASI_Hs01_00125134 predicted 998
4 SASI_Hs02_00304516 predicted 1267
5 SASI_Hs02_00304517 predicted 1161
6 SASI_Hs02_00304518 predicted 1160
7 SASI_Hs02_00304519 predicted 757
8 SASI_Hs01_00125136 predicted 917
9 SASI_Hs02_00304520 predicted 1221
10 SASI_Hs02_00304521 predicted 1098
11 SASI_Hs01_00125131 predicted 880
12 SASI_Hs01_00125133 predicted 977
13 SASI_Hs01_00125135 predicted 1075
14 SASI_Hs01_00125137 predicted 884
15 SASI_Hs01_00125138 predicted 271
16 SASI_Hs01_00125139 predicted 1073
17 SASI_Hs01_00125140 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168362 predicted 301
2 SASI_Rn01_00168363 predicted 221
3 SASI_Rn01_00168364 predicted 332
4 SASI_Rn01_00168365 predicted 291
5 SASI_Rn01_00168366 predicted 458
6 SASI_Rn01_00168367 predicted 384
7 SASI_Rn01_00168368 predicted 418
8 SASI_Rn01_00168369 predicted 341
9 SASI_Rn01_00168370 predicted 412
10 SASI_Rn01_00168371 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355410 predicted 355
2 SASI_Mm02_00355411 predicted 297
3 SASI_Mm02_00355412 predicted 262
4 SASI_Mm02_00355413 predicted 376
5 SASI_Mm02_00355414 predicted 436
6 SASI_Mm02_00355415 predicted 431
7 SASI_Mm02_00355416 predicted 257
8 SASI_Mm02_00355417 predicted 345
9 SASI_Mm02_00355418 predicted 299
10 SASI_Mm02_00355419 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00394256 predicted 355
2 SASI_Mm02_00394257 predicted 294
3 SASI_Mm02_00394258 predicted 262
4 SASI_Mm02_00394259 predicted 380
5 SASI_Mm02_00394260 predicted 431
6 SASI_Mm02_00394261 predicted 434
7 SASI_Mm02_00394262 predicted 264
8 SASI_Mm02_00394263 predicted 345
9 SASI_Mm02_00394264 predicted 299
10 SASI_Mm02_00394265 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004310
FCRL6 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-968s1c1
Sequence:CCGGGCTGCTGCACTTCTGGTTTATCTCGAGATAAACCAGAAGTGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-146s1c1
Sequence:CCGGCAGGTGAAGTTCTACAGAGATCTCGAGATCTCTGTAGAACTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-256s1c1
Sequence:CCGGGCAGGTGATGTATATTCCACACTCGAGTGTGGAATATACATCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-272s1c1
Sequence:CCGGCCACAGACATTCACACAAACTCTCGAGAGTTTGTGTGAATGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-123s1c1
Sequence:CCGGGATGGAAGAATACACCACTGTCTCGAGACAGTGGTGTATTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-883s1c1
Sequence:CCGGGAAGGGTTCTCAAGTCTTGTTCTCGAGAACAAGACTTGAGAACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004310
FCRL6 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-968s1c1
Sequence:CCGGGCTGCTGCACTTCTGGTTTATCTCGAGATAAACCAGAAGTGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-146s1c1
Sequence:CCGGCAGGTGAAGTTCTACAGAGATCTCGAGATCTCTGTAGAACTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-256s1c1
Sequence:CCGGGCAGGTGATGTATATTCCACACTCGAGTGTGGAATATACATCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-272s1c1
Sequence:CCGGCCACAGACATTCACACAAACTCTCGAGAGTTTGTGTGAATGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-123s1c1
Sequence:CCGGGATGGAAGAATACACCACTGTCTCGAGACAGTGGTGTATTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-883s1c1
Sequence:CCGGGAAGGGTTCTCAAGTCTTGTTCTCGAGAACAAGACTTGAGAACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004310
FCRL6 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-968s1c1
Sequence:CCGGGCTGCTGCACTTCTGGTTTATCTCGAGATAAACCAGAAGTGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-146s1c1
Sequence:CCGGCAGGTGAAGTTCTACAGAGATCTCGAGATCTCTGTAGAACTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-256s1c1
Sequence:CCGGGCAGGTGATGTATATTCCACACTCGAGTGTGGAATATACATCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-272s1c1
Sequence:CCGGCCACAGACATTCACACAAACTCTCGAGAGTTTGTGTGAATGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-123s1c1
Sequence:CCGGGATGGAAGAATACACCACTGTCTCGAGACAGTGGTGTATTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004310.1-883s1c1
Sequence:CCGGGAAGGGTTCTCAAGTCTTGTTCTCGAGAACAAGACTTGAGAACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks