EMAIL THIS PAGE TO A FRIEND

FCRLA

Fc receptor-like A

93 Gene Product Result for
Synonyms: FCRL FCRL1 FCRLM1 FCRLX FCRLb FCRLc1 FCRLc2 FCRLd FCRLe FCRX FREB
Gene ID:
Human(84824) Summary: This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(98752) Fc receptor-like A
Rat(304965) Fc receptor-like A
naked mole-rat(101702393) Fc receptor-like A
domestic guinea pig(100730064) Fc receptor-like A
sheep(101107325) Fc receptor-like A
cow(782871) Fc receptor-like A
domestic cat(101087297) Fc receptor-like A
dog(488658) Fc receptor-like A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080981 MISSION® esiRNA esiRNA human FCRLA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032738 Rosetta Predictions human pricing
XM_001072829 Rosetta Predictions rat pricing
XM_222876 Rosetta Predictions rat pricing
NM_145141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056993 predicted 801
2 SASI_Hs02_00360284 predicted 1344
3 SASI_Hs01_00056994 predicted 1105
4 SASI_Hs01_00056995 predicted 465
5 SASI_Hs01_00056997 predicted 590
6 SASI_Hs01_00056998 predicted 1290
7 SASI_Hs02_00360285 predicted 758
8 SASI_Hs01_00056999 predicted 461
9 SASI_Hs01_00057000 predicted 1018
10 SASI_Hs02_00360286 predicted 923
11 SASI_Hs01_00056996 predicted 1306
12 SASI_Hs01_00057001 predicted 791
13 SASI_Hs01_00057002 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340610 predicted 266
2 SASI_Rn02_00340611 predicted 975
3 SASI_Rn02_00340612 predicted 434
4 SASI_Rn02_00340613 predicted 771
5 SASI_Rn02_00340614 predicted 297
6 SASI_Rn02_00340615 predicted 956
7 SASI_Rn02_00340616 predicted 957
8 SASI_Rn02_00340617 predicted 606
9 SASI_Rn02_00340618 predicted 456
10 SASI_Rn02_00340619 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380967 predicted 261
2 SASI_Rn02_00380968 predicted 976
3 SASI_Rn02_00380969 predicted 434
4 SASI_Rn02_00380970 predicted 771
5 SASI_Rn02_00380971 predicted 303
6 SASI_Rn02_00380972 predicted 959
7 SASI_Rn02_00380973 predicted 959
8 SASI_Rn02_00380974 predicted 606
9 SASI_Rn02_00380975 predicted 459
10 SASI_Rn02_00380976 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068083 predicted 677
2 SASI_Mm01_00068084 predicted 263
3 SASI_Mm01_00068086 predicted 1042
4 SASI_Mm01_00068087 predicted 743
5 SASI_Mm02_00340538 predicted 282
6 SASI_Mm01_00068088 predicted 1043
7 SASI_Mm01_00068089 predicted 854
8 SASI_Mm01_00068091 predicted 344
9 SASI_Mm01_00068092 predicted 757
10 SASI_Mm02_00340539 predicted 593
11 SASI_Mm01_00068085 predicted 603
12 SASI_Mm01_00068090 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145141
FCRLA MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145141.1-1103s1c1
Sequence:CCGGCCGCAATAATTCCAGCTCTTTCTCGAGAAAGAGCTGGAATTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-293s1c1
Sequence:CCGGCCAGCTACATTGATATTTGAACTCGAGTTCAAATATCAATGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-355s1c1
Sequence:CCGGGCCACTGACTCAGGTTATCTTCTCGAGAAGATAACCTGAGTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-825s1c1
Sequence:CCGGCTCTTCAGAAACCAACCGCTTCTCGAGAAGCGGTTGGTTTCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-1047s1c1
Sequence:CCGGCCACGAAGGTTGCTGACAAATCTCGAGATTTGTCAGCAACCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145141.2-254s21c1
Sequence:CCGGCAGTTCAAGGGCTACACATTCCTCGAGGAATGTGTAGCCCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145141.2-1109s21c1
Sequence:CCGGGCTATTCACCTGCGCTATATTCTCGAGAATATAGCGCAGGTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145141.2-1215s21c1
Sequence:CCGGATGGAACTGTTCGAGTGTAAACTCGAGTTTACACTCGAACAGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145141
FCRLA MISSION shRNA shRNA Plasmid DNA
Fc receptor-like A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145141.1-1103s1c1
Sequence:CCGGCCGCAATAATTCCAGCTCTTTCTCGAGAAAGAGCTGGAATTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-293s1c1
Sequence:CCGGCCAGCTACATTGATATTTGAACTCGAGTTCAAATATCAATGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-355s1c1
Sequence:CCGGGCCACTGACTCAGGTTATCTTCTCGAGAAGATAACCTGAGTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-825s1c1
Sequence:CCGGCTCTTCAGAAACCAACCGCTTCTCGAGAAGCGGTTGGTTTCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-1047s1c1
Sequence:CCGGCCACGAAGGTTGCTGACAAATCTCGAGATTTGTCAGCAACCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145141.2-254s21c1
Sequence:CCGGCAGTTCAAGGGCTACACATTCCTCGAGGAATGTGTAGCCCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145141.2-1109s21c1
Sequence:CCGGGCTATTCACCTGCGCTATATTCTCGAGAATATAGCGCAGGTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145141.2-1215s21c1
Sequence:CCGGATGGAACTGTTCGAGTGTAAACTCGAGTTTACACTCGAACAGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145141
FCRLA MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145141.1-1103s1c1
Sequence:CCGGCCGCAATAATTCCAGCTCTTTCTCGAGAAAGAGCTGGAATTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-293s1c1
Sequence:CCGGCCAGCTACATTGATATTTGAACTCGAGTTCAAATATCAATGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-355s1c1
Sequence:CCGGGCCACTGACTCAGGTTATCTTCTCGAGAAGATAACCTGAGTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-825s1c1
Sequence:CCGGCTCTTCAGAAACCAACCGCTTCTCGAGAAGCGGTTGGTTTCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145141.1-1047s1c1
Sequence:CCGGCCACGAAGGTTGCTGACAAATCTCGAGATTTGTCAGCAACCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145141.2-254s21c1
Sequence:CCGGCAGTTCAAGGGCTACACATTCCTCGAGGAATGTGTAGCCCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145141.2-1109s21c1
Sequence:CCGGGCTATTCACCTGCGCTATATTCTCGAGAATATAGCGCAGGTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145141.2-1215s21c1
Sequence:CCGGATGGAACTGTTCGAGTGTAAACTCGAGTTTACACTCGAACAGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032738
FCRLA MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-1263s1c1
Sequence:CCGGCTTCTCAAACACATGCAGGATCTCGAGATCCTGCATGTGTTTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-792s1c1
Sequence:CCGGGAACTGTTTCCAGCGCCAATTCTCGAGAATTGGCGCTGGAAACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-444s1c1
Sequence:CCGGGACTTGACTGATGCAAGGGAACTCGAGTTCCCTTGCATCAGTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-1026s1c1
Sequence:CCGGGAGGACAACCAAGTTTGGAAACTCGAGTTTCCAAACTTGGTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-485s1c1
Sequence:CCGGCTACACTTTCAGTGAACCCTTCTCGAGAAGGGTTCACTGAAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032738.3-1500s21c1
Sequence:CCGGGTAGTTAGGTGAGTGTAAATACTCGAGTATTTACACTCACCTAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032738.3-987s21c1
Sequence:CCGGGAAGATCACTCCGGGTCATACCTCGAGGTATGACCCGGAGTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032738.3-1621s21c1
Sequence:CCGGTCGACCAGAATGTTGTGATTTCTCGAGAAATCACAACATTCTGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032738
FCRLA MISSION shRNA shRNA Plasmid DNA
Fc receptor-like A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-1263s1c1
Sequence:CCGGCTTCTCAAACACATGCAGGATCTCGAGATCCTGCATGTGTTTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-792s1c1
Sequence:CCGGGAACTGTTTCCAGCGCCAATTCTCGAGAATTGGCGCTGGAAACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-444s1c1
Sequence:CCGGGACTTGACTGATGCAAGGGAACTCGAGTTCCCTTGCATCAGTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-1026s1c1
Sequence:CCGGGAGGACAACCAAGTTTGGAAACTCGAGTTTCCAAACTTGGTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-485s1c1
Sequence:CCGGCTACACTTTCAGTGAACCCTTCTCGAGAAGGGTTCACTGAAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032738.3-1500s21c1
Sequence:CCGGGTAGTTAGGTGAGTGTAAATACTCGAGTATTTACACTCACCTAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032738.3-987s21c1
Sequence:CCGGGAAGATCACTCCGGGTCATACCTCGAGGTATGACCCGGAGTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032738.3-1621s21c1
Sequence:CCGGTCGACCAGAATGTTGTGATTTCTCGAGAAATCACAACATTCTGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032738
FCRLA MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-1263s1c1
Sequence:CCGGCTTCTCAAACACATGCAGGATCTCGAGATCCTGCATGTGTTTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-792s1c1
Sequence:CCGGGAACTGTTTCCAGCGCCAATTCTCGAGAATTGGCGCTGGAAACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-444s1c1
Sequence:CCGGGACTTGACTGATGCAAGGGAACTCGAGTTCCCTTGCATCAGTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-1026s1c1
Sequence:CCGGGAGGACAACCAAGTTTGGAAACTCGAGTTTCCAAACTTGGTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032738.3-485s1c1
Sequence:CCGGCTACACTTTCAGTGAACCCTTCTCGAGAAGGGTTCACTGAAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032738.3-1500s21c1
Sequence:CCGGGTAGTTAGGTGAGTGTAAATACTCGAGTATTTACACTCACCTAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032738.3-987s21c1
Sequence:CCGGGAAGATCACTCCGGGTCATACCTCGAGGTATGACCCGGAGTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032738.3-1621s21c1
Sequence:CCGGTCGACCAGAATGTTGTGATTTCTCGAGAAATCACAACATTCTGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks