EMAIL THIS PAGE TO A FRIEND

FCRLB

Fc receptor-like B

129 Gene Product Result for
Synonyms: FCRL2 FCRLM2 FCRLY FREB-2 FcRY
Gene ID:
Human(127943) Summary: FCRL2 belongs to the Fc receptor family. Fc receptors are involved in phagocytosis, antibody-dependent cell cytotoxicity, immediate hypersensitivity, and transcytosis of immunoglobulins via their ability to bind immunoglobulin (Ig) constant regions (Chikaev et al., 2005 [PubMed 15676285]
Mouse(435653) Fc receptor-like B
Rat(498275) Fc receptor-like B
cow(522702) Fc receptor-like B
domestic cat(101087040) Fc receptor-like B
dog(609689) Fc receptor-like B
sheep(101106984) Fc receptor-like B
domestic guinea pig(100715396) Fc receptor-like B
naked mole-rat(101704785) Fc receptor-like B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1457 Human FCRLB ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152378 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002901 Rosetta Predictions human pricing
XM_001076935 Rosetta Predictions rat pricing
XM_573501 Rosetta Predictions rat pricing
NM_001029984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188132 predicted 911
2 SASI_Hs01_00188133 predicted 345
3 SASI_Hs01_00188134 predicted 553
4 SASI_Hs02_00304247 predicted 194
5 SASI_Hs01_00188135 predicted 1440
6 SASI_Hs01_00188136 predicted 1110
7 SASI_Hs01_00188137 predicted 933
8 SASI_Hs01_00188138 predicted 294
9 SASI_Hs01_00188139 predicted 376
10 SASI_Hs01_00188140 predicted 1347
11 SASI_Hs01_00188131 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355095 predicted 949
2 SASI_Rn02_00355096 predicted 973
3 SASI_Rn02_00355097 predicted 311
4 SASI_Rn02_00355098 predicted 322
5 SASI_Rn02_00355099 predicted 1036
6 SASI_Rn02_00355100 predicted 367
7 SASI_Rn02_00355101 predicted 290
8 SASI_Rn02_00355102 predicted 424
9 SASI_Rn02_00355103 predicted 487
10 SASI_Rn02_00355104 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400394 predicted 950
2 SASI_Rn02_00400395 predicted 950
3 SASI_Rn02_00400396 predicted 970
4 SASI_Rn02_00400397 predicted 958
5 SASI_Rn02_00400398 predicted 942
6 SASI_Rn02_00400399 predicted 920
7 SASI_Rn02_00400400 predicted 964
8 SASI_Rn02_00400401 predicted 989
9 SASI_Rn02_00400402 predicted 951
10 SASI_Rn02_00400403 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074789 predicted 676
2 SASI_Mm01_00074790 predicted 304
3 SASI_Mm01_00074791 predicted 965
4 SASI_Mm01_00074792 predicted 560
5 SASI_Mm02_00288085 predicted 419
6 SASI_Mm01_00074793 predicted 319
7 SASI_Mm01_00074794 predicted 236
8 SASI_Mm01_00074795 predicted 337
9 SASI_Mm01_00074796 predicted 922
10 SASI_Mm01_00074797 predicted 375
11 SASI_Mm01_00074798 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002901
FCRLB MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000438030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-921s21c1
Sequence:CCGGAGCCTTGGCTCCTGGTAATAGCTCGAGCTATTACCAGGAGCCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002901.2-1573s21c1
Sequence:CCGGATAAGCCTAGCCAGTACATATCTCGAGATATGTACTGGCTAGGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-305s21c1
Sequence:CCGGTATCCAATGATTGGCTGATTCCTCGAGGAATCAGCCAATCATTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-174s21c1
Sequence:CCGGCATCAGCACTCTCTGGTATTTCTCGAGAAATACCAGAGAGTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002901
FCRLB MISSION shRNA shRNA Plasmid DNA
Fc receptor-like B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000438030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-921s21c1
Sequence:CCGGAGCCTTGGCTCCTGGTAATAGCTCGAGCTATTACCAGGAGCCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002901.2-1573s21c1
Sequence:CCGGATAAGCCTAGCCAGTACATATCTCGAGATATGTACTGGCTAGGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-305s21c1
Sequence:CCGGTATCCAATGATTGGCTGATTCCTCGAGGAATCAGCCAATCATTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-174s21c1
Sequence:CCGGCATCAGCACTCTCTGGTATTTCTCGAGAAATACCAGAGAGTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002901
FCRLB MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000438030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-921s21c1
Sequence:CCGGAGCCTTGGCTCCTGGTAATAGCTCGAGCTATTACCAGGAGCCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002901.2-1573s21c1
Sequence:CCGGATAAGCCTAGCCAGTACATATCTCGAGATATGTACTGGCTAGGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-305s21c1
Sequence:CCGGTATCCAATGATTGGCTGATTCCTCGAGGAATCAGCCAATCATTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002901.2-174s21c1
Sequence:CCGGCATCAGCACTCTCTGGTATTTCTCGAGAAATACCAGAGAGTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152378
VALIDATED
FCRLB MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152378.1-1764s1c1
Sequence:CCGGGATGTGAATTTAGTCACCCTTCTCGAGAAGGGTGACTAAATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152378.1-1718s1c1
Sequence:CCGGGCAAGAAGTAGAAACCTGTTACTCGAGTAACAGGTTTCTACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152378.1-1570s1c1
Sequence:CCGGGCGAATTTCTTTCAAAGCCATCTCGAGATGGCTTTGAAAGAAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152378.1-306s1c1
Sequence:CCGGCTTAGACTATGGACGCTGTCTCTCGAGAGACAGCGTCCATAGTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152378.1-271s1c1
Sequence:CCGGCGGAAGTTCAAATAGCTGCCACTCGAGTGGCAGCTATTTGAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152378.1-1683s1c1
Sequence:CCGGCCGCAAGCATTCTCTTTGAATCTCGAGATTCAAAGAGAATGCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152378
VALIDATED
FCRLB MISSION shRNA shRNA Plasmid DNA
Fc receptor-like B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152378.1-1764s1c1
Sequence:CCGGGATGTGAATTTAGTCACCCTTCTCGAGAAGGGTGACTAAATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152378.1-1718s1c1
Sequence:CCGGGCAAGAAGTAGAAACCTGTTACTCGAGTAACAGGTTTCTACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152378.1-1570s1c1
Sequence:CCGGGCGAATTTCTTTCAAAGCCATCTCGAGATGGCTTTGAAAGAAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152378.1-306s1c1
Sequence:CCGGCTTAGACTATGGACGCTGTCTCTCGAGAGACAGCGTCCATAGTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152378.1-271s1c1
Sequence:CCGGCGGAAGTTCAAATAGCTGCCACTCGAGTGGCAGCTATTTGAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152378.1-1683s1c1
Sequence:CCGGCCGCAAGCATTCTCTTTGAATCTCGAGATTCAAAGAGAATGCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152378
VALIDATED
FCRLB MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152378.1-1764s1c1
Sequence:CCGGGATGTGAATTTAGTCACCCTTCTCGAGAAGGGTGACTAAATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152378.1-1718s1c1
Sequence:CCGGGCAAGAAGTAGAAACCTGTTACTCGAGTAACAGGTTTCTACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152378.1-1570s1c1
Sequence:CCGGGCGAATTTCTTTCAAAGCCATCTCGAGATGGCTTTGAAAGAAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152378.1-306s1c1
Sequence:CCGGCTTAGACTATGGACGCTGTCTCTCGAGAGACAGCGTCCATAGTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152378.1-271s1c1
Sequence:CCGGCGGAAGTTCAAATAGCTGCCACTCGAGTGGCAGCTATTTGAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152378.1-1683s1c1
Sequence:CCGGCCGCAAGCATTCTCTTTGAATCTCGAGATTCAAAGAGAATGCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029984
FCRLB MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-52s1c1
Sequence:CCGGGCTACTCTGGAGAAGCCTATACTCGAGTATAGGCTTCTCCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-306s1c1
Sequence:CCGGCGACTGGCTAATTCTGCAAGTCTCGAGACTTGCAGAATTAGCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-427s1c1
Sequence:CCGGGCTGTGAGATATTTCCACTCTCTCGAGAGAGTGGAAATATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-393s1c1
Sequence:CCGGCGTCTACAAACTTCACTACTACTCGAGTAGTAGTGAAGTTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-960s1c1
Sequence:CCGGCGTTCAGTCAGTCACTTCCATCTCGAGATGGAAGTGACTGACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029984
FCRLB MISSION shRNA shRNA Plasmid DNA
Fc receptor-like B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-52s1c1
Sequence:CCGGGCTACTCTGGAGAAGCCTATACTCGAGTATAGGCTTCTCCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-306s1c1
Sequence:CCGGCGACTGGCTAATTCTGCAAGTCTCGAGACTTGCAGAATTAGCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-427s1c1
Sequence:CCGGGCTGTGAGATATTTCCACTCTCTCGAGAGAGTGGAAATATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-393s1c1
Sequence:CCGGCGTCTACAAACTTCACTACTACTCGAGTAGTAGTGAAGTTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-960s1c1
Sequence:CCGGCGTTCAGTCAGTCACTTCCATCTCGAGATGGAAGTGACTGACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029984
FCRLB MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-52s1c1
Sequence:CCGGGCTACTCTGGAGAAGCCTATACTCGAGTATAGGCTTCTCCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-306s1c1
Sequence:CCGGCGACTGGCTAATTCTGCAAGTCTCGAGACTTGCAGAATTAGCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-427s1c1
Sequence:CCGGGCTGTGAGATATTTCCACTCTCTCGAGAGAGTGGAAATATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-393s1c1
Sequence:CCGGCGTCTACAAACTTCACTACTACTCGAGTAGTAGTGAAGTTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029984.1-960s1c1
Sequence:CCGGCGTTCAGTCAGTCACTTCCATCTCGAGATGGAAGTGACTGACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks