EMAIL THIS PAGE TO A FRIEND

FDCSP

follicular dendritic cell secreted protein

21 Gene Product Result for
Synonyms: C4orf7 FDC-SP
Species: Human FDCSP(260436)
UniProtKB ID: Q8NFU4
Gene ID:
Human(260436) Summary: This gene encodes a small secreted protein that is expressed in follicular dendritic cells. This protein specifically binds to activated B cells, and functions as a regulator of antibody responses. It is also thought to contribute to tumor metastases by promoting cancer cell migration and invasion. [provided by RefSeq, Dec 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152997 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057681 MISSION® esiRNA esiRNA human C4orf7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152997 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071913 predicted 232
2 SASI_Hs01_00071915 predicted 229
3 SASI_Hs02_00366952 predicted 234
4 SASI_Hs01_00071916 predicted 253
5 SASI_Hs01_00071917 predicted 248
6 SASI_Hs01_00071919 predicted 255
7 SASI_Hs01_00071920 predicted 220
8 SASI_Hs02_00366953 predicted 235
9 SASI_Hs02_00366954 predicted 265
10 SASI_Hs02_00366955 predicted 258
11 SASI_Hs01_00071914 predicted 244
12 SASI_Hs01_00071918 predicted 263
13 SASI_Hs01_00071921 predicted 242
14 SASI_Hs01_00071922 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152997
FDCSP MISSION shRNA Bacterial Glycerol Stock
follicular dendritic cell secreted protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-176s21c1
Sequence:CCGGATCAGTGACAGCGATGAATTACTCGAGTAATTCATCGCTGTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152997.2-369s21c1
Sequence:CCGGCTGGTCACCTGAAATTGAAATCTCGAGATTTCAATTTCAGGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-239s21c1
Sequence:CCGGCCACTTCCACCAATTCCATTTCTCGAGAAATGGAATTGGTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-268s21c1
Sequence:CCGGTCCATGGTTTAGACGTAATTTCTCGAGAAATTACGTCTAAACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-216s21c1
Sequence:CCGGTCCCTTACCCATATCCATTTCCTCGAGGAAATGGATATGGGTAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152997.1-94s1c1
Sequence:CCGGGTTGGTTTCCCAGTCTCTCAACTCGAGTTGAGAGACTGGGAAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152997
FDCSP MISSION shRNA shRNA Plasmid DNA
follicular dendritic cell secreted protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-176s21c1
Sequence:CCGGATCAGTGACAGCGATGAATTACTCGAGTAATTCATCGCTGTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152997.2-369s21c1
Sequence:CCGGCTGGTCACCTGAAATTGAAATCTCGAGATTTCAATTTCAGGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-239s21c1
Sequence:CCGGCCACTTCCACCAATTCCATTTCTCGAGAAATGGAATTGGTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-268s21c1
Sequence:CCGGTCCATGGTTTAGACGTAATTTCTCGAGAAATTACGTCTAAACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-216s21c1
Sequence:CCGGTCCCTTACCCATATCCATTTCCTCGAGGAAATGGATATGGGTAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152997.1-94s1c1
Sequence:CCGGGTTGGTTTCCCAGTCTCTCAACTCGAGTTGAGAGACTGGGAAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152997
FDCSP MISSION shRNA Lentiviral Transduction Particles
follicular dendritic cell secreted protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-176s21c1
Sequence:CCGGATCAGTGACAGCGATGAATTACTCGAGTAATTCATCGCTGTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152997.2-369s21c1
Sequence:CCGGCTGGTCACCTGAAATTGAAATCTCGAGATTTCAATTTCAGGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-239s21c1
Sequence:CCGGCCACTTCCACCAATTCCATTTCTCGAGAAATGGAATTGGTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-268s21c1
Sequence:CCGGTCCATGGTTTAGACGTAATTTCTCGAGAAATTACGTCTAAACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152997.2-216s21c1
Sequence:CCGGTCCCTTACCCATATCCATTTCCTCGAGGAAATGGATATGGGTAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152997.1-94s1c1
Sequence:CCGGGTTGGTTTCCCAGTCTCTCAACTCGAGTTGAGAGACTGGGAAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks