EMAIL THIS PAGE TO A FRIEND

FDFT1

farnesyl-diphosphate farnesyltransferase 1

62 Gene Product Result for
Synonyms: DGPT ERG9 SQS SS
UniProtKB ID: P37268, Q96GT0
Gene ID:
Human(2222) Summary: This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
Mouse(14137) farnesyl diphosphate farnesyl transferase 1
Rat(29580) farnesyl diphosphate farnesyl transferase 1
chicken(422038) farnesyl-diphosphate farnesyltransferase 1
domestic cat(101084620) farnesyl-diphosphate farnesyltransferase 1
cow(281767) farnesyl-diphosphate farnesyltransferase 1
dog(477362) farnesyl-diphosphate farnesyltransferase 1
sheep(101119109) farnesyl-diphosphate farnesyltransferase 1
Domestic Rabbit(100345480) farnesyl-diphosphate farnesyltransferase 1
naked mole-rat(101709374) farnesyl-diphosphate farnesyltransferase 1
domestic guinea pig(100714445) farnesyl-diphosphate farnesyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004462 siRNAs that have been validated in the lab human pricing
NM_019238 Rosetta Predictions rat pricing
NM_010191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004462 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041537 validated 1161
1 SASI_Hs01_00041538 validated 1405
1 SASI_Hs01_00041539 validated 1491
2 SASI_Hs02_00337656 predicted 826
3 SASI_Hs01_00041541 predicted 792
4 SASI_Hs01_00041542 predicted 569
5 SASI_Hs01_00041543 predicted 689
6 SASI_Hs02_00337657 predicted 519
7 SASI_Hs01_00041544 predicted 275
8 SASI_Hs01_00041546 predicted 281
9 SASI_Hs02_00337658 predicted 682
10 SASI_Hs02_00337659 predicted 559
11 SASI_Hs02_00337660 predicted 650
12 SASI_Hs01_00041540 predicted 1175
13 SASI_Hs01_00041545 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073395 predicted 1000
2 SASI_Rn01_00073396 predicted 1081
3 SASI_Rn01_00073397 predicted 713
4 SASI_Rn01_00073399 predicted 476
5 SASI_Rn02_00262109 predicted 369
6 SASI_Rn01_00073400 predicted 581
7 SASI_Rn01_00073401 predicted 719
8 SASI_Rn01_00073402 predicted 1086
9 SASI_Rn01_00073403 predicted 465
10 SASI_Rn01_00073404 predicted 588
11 SASI_Rn01_00073398 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157817 predicted 1017
2 SASI_Mm02_00317991 predicted 646
3 SASI_Mm02_00317992 predicted 414
4 SASI_Mm02_00317993 predicted 608
5 SASI_Mm01_00157820 predicted 547
6 SASI_Mm02_00317994 predicted 212
7 SASI_Mm01_00157823 predicted 716
8 SASI_Mm02_00317995 predicted 424
9 SASI_Mm02_00317996 predicted 1058
10 SASI_Mm02_00317997 predicted 509
11 SASI_Mm01_00157818 predicted 887
12 SASI_Mm01_00157819 predicted 1143
13 SASI_Mm01_00157821 predicted 887
14 SASI_Mm01_00157822 predicted 552
15 SASI_Mm01_00157824 predicted 1025
16 SASI_Mm01_00157825 predicted 1029
17 SASI_Mm01_00157826 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010191
VALIDATED
FDFT1 MISSION shRNA Bacterial Glycerol Stock
farnesyl-diphosphate farnesyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-1018s1c1
Sequence:CCGGGCTATCATATACCAGTACATACTCGAGTATGTACTGGTATATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010191.2-933s1c1
Sequence:CCGGGCAGGTATTCAAAGGAGTAGTCTCGAGACTACTCCTTTGAATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-865s1c1
Sequence:CCGGGTGTTTAACTTCTGTGCTATTCTCGAGAATAGCACAGAAGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-781s1c1
Sequence:CCGGCAGTGCTTGAATGAACTCATACTCGAGTATGAGTTCATTCAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010191.2-722s21c1
Sequence:CCGGGCAGATACATTAAGAAGTTGGCTCGAGCCAACTTCTTAATGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010191.2-1633s21c1
Sequence:CCGGGTTTGACAGTGGAAGTGTTAACTCGAGTTAACACTTCCACTGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-50s21c1
Sequence:CCGGTCTATAACCTGCTGCGATTCCCTCGAGGGAATCGCAGCAGGTTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-781s21c1
Sequence:CCGGCAGTGCTTGAATGAACTCATACTCGAGTATGAGTTCATTCAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-865s21c1
Sequence:CCGGGTGTTTAACTTCTGTGCTATTCTCGAGAATAGCACAGAAGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010191
VALIDATED
FDFT1 MISSION shRNA shRNA Plasmid DNA
farnesyl-diphosphate farnesyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-1018s1c1
Sequence:CCGGGCTATCATATACCAGTACATACTCGAGTATGTACTGGTATATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010191.2-933s1c1
Sequence:CCGGGCAGGTATTCAAAGGAGTAGTCTCGAGACTACTCCTTTGAATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-865s1c1
Sequence:CCGGGTGTTTAACTTCTGTGCTATTCTCGAGAATAGCACAGAAGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-781s1c1
Sequence:CCGGCAGTGCTTGAATGAACTCATACTCGAGTATGAGTTCATTCAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010191.2-722s21c1
Sequence:CCGGGCAGATACATTAAGAAGTTGGCTCGAGCCAACTTCTTAATGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010191.2-1633s21c1
Sequence:CCGGGTTTGACAGTGGAAGTGTTAACTCGAGTTAACACTTCCACTGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-50s21c1
Sequence:CCGGTCTATAACCTGCTGCGATTCCCTCGAGGGAATCGCAGCAGGTTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-781s21c1
Sequence:CCGGCAGTGCTTGAATGAACTCATACTCGAGTATGAGTTCATTCAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-865s21c1
Sequence:CCGGGTGTTTAACTTCTGTGCTATTCTCGAGAATAGCACAGAAGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010191
VALIDATED
FDFT1 MISSION shRNA Lentiviral Transduction Particles
farnesyl-diphosphate farnesyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-1018s1c1
Sequence:CCGGGCTATCATATACCAGTACATACTCGAGTATGTACTGGTATATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010191.2-933s1c1
Sequence:CCGGGCAGGTATTCAAAGGAGTAGTCTCGAGACTACTCCTTTGAATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-865s1c1
Sequence:CCGGGTGTTTAACTTCTGTGCTATTCTCGAGAATAGCACAGAAGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010191.2-781s1c1
Sequence:CCGGCAGTGCTTGAATGAACTCATACTCGAGTATGAGTTCATTCAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010191.2-722s21c1
Sequence:CCGGGCAGATACATTAAGAAGTTGGCTCGAGCCAACTTCTTAATGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010191.2-1633s21c1
Sequence:CCGGGTTTGACAGTGGAAGTGTTAACTCGAGTTAACACTTCCACTGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-50s21c1
Sequence:CCGGTCTATAACCTGCTGCGATTCCCTCGAGGGAATCGCAGCAGGTTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-781s21c1
Sequence:CCGGCAGTGCTTGAATGAACTCATACTCGAGTATGAGTTCATTCAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010191.2-865s21c1
Sequence:CCGGGTGTTTAACTTCTGTGCTATTCTCGAGAATAGCACAGAAGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004462
VALIDATED
FDFT1 MISSION shRNA Bacterial Glycerol Stock
farnesyl-diphosphate farnesyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-215s1c1
Sequence:CCGGACTTGCTACAAGTATCTCAATCTCGAGATTGAGATACTTGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-1248s1c1
Sequence:CCGGACCTGTCGTTTGTCATGCTTTCTCGAGAAAGCATGACAAACGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-287s1c1
Sequence:CCGGCGCAACGCAGTGTGCATATTTCTCGAGAAATATGCACACTGCGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-915s1c1
Sequence:CCGGCCTACCTTTCGAGACTCAGAACTCGAGTTCTGAGTCTCGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-731s1c1
Sequence:CCGGACAAACATCATCCGTGACTATCTCGAGATAGTCACGGATGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-529s21c1
Sequence:CCGGCAACGATCTCCCTTGAGTTTACTCGAGTAAACTCAAGGGAGATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-976s21c1
Sequence:CCGGCCTACCTTTCGAGACTCAGAACTCGAGTTCTGAGTCTCGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-276s21c1
Sequence:CCGGACTTGCTACAAGTATCTCAATCTCGAGATTGAGATACTTGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004462.3-1148s21c1
Sequence:CCGGAGCTGTCAAAGCCATCATATACTCGAGTATATGATGGCTTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004462.3-1762s21c1
Sequence:CCGGACCATTTGAATGTTCGTAATACTCGAGTATTACGAACATTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004462
VALIDATED
FDFT1 MISSION shRNA shRNA Plasmid DNA
farnesyl-diphosphate farnesyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-215s1c1
Sequence:CCGGACTTGCTACAAGTATCTCAATCTCGAGATTGAGATACTTGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-1248s1c1
Sequence:CCGGACCTGTCGTTTGTCATGCTTTCTCGAGAAAGCATGACAAACGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-287s1c1
Sequence:CCGGCGCAACGCAGTGTGCATATTTCTCGAGAAATATGCACACTGCGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-915s1c1
Sequence:CCGGCCTACCTTTCGAGACTCAGAACTCGAGTTCTGAGTCTCGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-731s1c1
Sequence:CCGGACAAACATCATCCGTGACTATCTCGAGATAGTCACGGATGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-529s21c1
Sequence:CCGGCAACGATCTCCCTTGAGTTTACTCGAGTAAACTCAAGGGAGATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-976s21c1
Sequence:CCGGCCTACCTTTCGAGACTCAGAACTCGAGTTCTGAGTCTCGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-276s21c1
Sequence:CCGGACTTGCTACAAGTATCTCAATCTCGAGATTGAGATACTTGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004462.3-1148s21c1
Sequence:CCGGAGCTGTCAAAGCCATCATATACTCGAGTATATGATGGCTTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004462.3-1762s21c1
Sequence:CCGGACCATTTGAATGTTCGTAATACTCGAGTATTACGAACATTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004462
VALIDATED
FDFT1 MISSION shRNA Lentiviral Transduction Particles
farnesyl-diphosphate farnesyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-215s1c1
Sequence:CCGGACTTGCTACAAGTATCTCAATCTCGAGATTGAGATACTTGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-1248s1c1
Sequence:CCGGACCTGTCGTTTGTCATGCTTTCTCGAGAAAGCATGACAAACGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-287s1c1
Sequence:CCGGCGCAACGCAGTGTGCATATTTCTCGAGAAATATGCACACTGCGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-915s1c1
Sequence:CCGGCCTACCTTTCGAGACTCAGAACTCGAGTTCTGAGTCTCGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004462.2-731s1c1
Sequence:CCGGACAAACATCATCCGTGACTATCTCGAGATAGTCACGGATGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-529s21c1
Sequence:CCGGCAACGATCTCCCTTGAGTTTACTCGAGTAAACTCAAGGGAGATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-976s21c1
Sequence:CCGGCCTACCTTTCGAGACTCAGAACTCGAGTTCTGAGTCTCGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004462.3-276s21c1
Sequence:CCGGACTTGCTACAAGTATCTCAATCTCGAGATTGAGATACTTGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004462.3-1148s21c1
Sequence:CCGGAGCTGTCAAAGCCATCATATACTCGAGTATATGATGGCTTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004462.3-1762s21c1
Sequence:CCGGACCATTTGAATGTTCGTAATACTCGAGTATTACGAACATTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks