EMAIL THIS PAGE TO A FRIEND

FDPS

farnesyl diphosphate synthase

57 Gene Product Result for
Synonyms: FPPS FPS
UniProtKB ID: P14324, D3DV91, E9PCI9, Q96G29
Gene ID:
Human(2224) Summary: This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Mouse(110196) farnesyl diphosphate synthetase
Rat(83791) farnesyl diphosphate synthase
sheep(101119093) farnesyl diphosphate synthase
domestic guinea pig(100717025) farnesyl diphosphate synthase
naked mole-rat(101721614) farnesyl diphosphate synthase
Zebrafish(552997) farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase)
cow(281156) farnesyl diphosphate synthase
Horse(100063641) farnesyl diphosphate synthase
domestic cat(101086533) farnesyl diphosphate synthase
dog(480129) farnesyl diphosphate synthase
chicken(425061) farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002004 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002004 Rosetta Predictions human pricing
NM_031840 Rosetta Predictions rat pricing
NM_134469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029910 predicted 772
2 SASI_Hs01_00029911 predicted 840
3 SASI_Hs01_00029912 predicted 742
4 SASI_Hs01_00029913 predicted 839
5 SASI_Hs01_00029915 predicted 853
6 SASI_Hs01_00029916 predicted 684
7 SASI_Hs01_00029917 predicted 1080
8 SASI_Hs01_00029918 predicted 196
9 SASI_Hs01_00029914 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265341 predicted 565
2 SASI_Rn02_00265342 predicted 994
3 SASI_Rn02_00265343 predicted 563
4 SASI_Rn01_00040520 predicted 553
5 SASI_Rn01_00040521 predicted 285
6 SASI_Rn02_00265344 predicted 987
7 SASI_Rn01_00040524 predicted 278
8 SASI_Rn01_00040525 predicted 822
9 SASI_Rn01_00040526 predicted 995
10 SASI_Rn02_00265345 predicted 439
11 SASI_Rn01_00040519 predicted 277
12 SASI_Rn01_00040522 predicted 801
13 SASI_Rn01_00040523 predicted 797
14 SASI_Rn01_00040527 predicted 271
15 SASI_Rn01_00040528 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090402 predicted 256
2 SASI_Mm01_00090403 predicted 730
3 SASI_Mm01_00090407 predicted 610
4 SASI_Mm01_00090408 predicted 942
5 SASI_Mm02_00339576 predicted 391
6 SASI_Mm01_00090411 predicted 860
7 SASI_Mm01_00090404 predicted 219
8 SASI_Mm02_00339577 predicted 788
9 SASI_Mm02_00339578 predicted 362
10 SASI_Mm02_00339579 predicted 1000
11 SASI_Mm01_00090405 predicted 224
12 SASI_Mm01_00090406 predicted 477
13 SASI_Mm01_00090409 predicted 954
14 SASI_Mm01_00090410 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134469
VALIDATED
FDPS MISSION shRNA Bacterial Glycerol Stock
farnesyl diphosphate synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-148s21c1
Sequence:CCGGGCAGAATTTCATCCAGCACTTCTCGAGAAGTGCTGGATGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-953s21c1
Sequence:CCGGCGCCAGATCTTAGAGGAGAATCTCGAGATTCTCCTCTAAGATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-395s21c1
Sequence:CCGGGCTTTCTTCCTTGTGTCAGATCTCGAGATCTGACACAAGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-1043s21c1
Sequence:CCGGGCTTTCTTCAAGTATGAGGAACTCGAGTTCCTCATACTTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-148s1c1
Sequence:CCGGGCAGAATTTCATCCAGCACTTCTCGAGAAGTGCTGGATGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-395s1c1
Sequence:CCGGGCTTTCTTCCTTGTGTCAGATCTCGAGATCTGACACAAGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-953s1c1
Sequence:CCGGCGCCAGATCTTAGAGGAGAATCTCGAGATTCTCCTCTAAGATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-648s1c1
Sequence:CCGGGCCATGTGGATCTTGGTAGATCTCGAGATCTACCAAGATCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-1043s1c1
Sequence:CCGGGCTTTCTTCAAGTATGAGGAACTCGAGTTCCTCATACTTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134469
VALIDATED
FDPS MISSION shRNA shRNA Plasmid DNA
farnesyl diphosphate synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-148s21c1
Sequence:CCGGGCAGAATTTCATCCAGCACTTCTCGAGAAGTGCTGGATGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-953s21c1
Sequence:CCGGCGCCAGATCTTAGAGGAGAATCTCGAGATTCTCCTCTAAGATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-395s21c1
Sequence:CCGGGCTTTCTTCCTTGTGTCAGATCTCGAGATCTGACACAAGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-1043s21c1
Sequence:CCGGGCTTTCTTCAAGTATGAGGAACTCGAGTTCCTCATACTTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-148s1c1
Sequence:CCGGGCAGAATTTCATCCAGCACTTCTCGAGAAGTGCTGGATGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-395s1c1
Sequence:CCGGGCTTTCTTCCTTGTGTCAGATCTCGAGATCTGACACAAGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-953s1c1
Sequence:CCGGCGCCAGATCTTAGAGGAGAATCTCGAGATTCTCCTCTAAGATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-648s1c1
Sequence:CCGGGCCATGTGGATCTTGGTAGATCTCGAGATCTACCAAGATCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-1043s1c1
Sequence:CCGGGCTTTCTTCAAGTATGAGGAACTCGAGTTCCTCATACTTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134469
VALIDATED
FDPS MISSION shRNA Lentiviral Transduction Particles
farnesyl diphosphate synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-148s21c1
Sequence:CCGGGCAGAATTTCATCCAGCACTTCTCGAGAAGTGCTGGATGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-953s21c1
Sequence:CCGGCGCCAGATCTTAGAGGAGAATCTCGAGATTCTCCTCTAAGATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-395s21c1
Sequence:CCGGGCTTTCTTCCTTGTGTCAGATCTCGAGATCTGACACAAGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134469.3-1043s21c1
Sequence:CCGGGCTTTCTTCAAGTATGAGGAACTCGAGTTCCTCATACTTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-148s1c1
Sequence:CCGGGCAGAATTTCATCCAGCACTTCTCGAGAAGTGCTGGATGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-395s1c1
Sequence:CCGGGCTTTCTTCCTTGTGTCAGATCTCGAGATCTGACACAAGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-953s1c1
Sequence:CCGGCGCCAGATCTTAGAGGAGAATCTCGAGATTCTCCTCTAAGATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-648s1c1
Sequence:CCGGGCCATGTGGATCTTGGTAGATCTCGAGATCTACCAAGATCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134469.2-1043s1c1
Sequence:CCGGGCTTTCTTCAAGTATGAGGAACTCGAGTTCCTCATACTTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002004
VALIDATED
FDPS MISSION shRNA Bacterial Glycerol Stock
farnesyl diphosphate synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-1348s21c1
Sequence:CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-522s21c1
Sequence:CCGGCCCAGAGATAGGAGATGCTATCTCGAGATAGCATCTCCTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-459s21c1
Sequence:CCGGGCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-1054s21c1
Sequence:CCGGGCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-559s21c1
Sequence:CCGGGTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-311s1c1
Sequence:CCGGCCCAGAGATAGGAGATGCTATCTCGAGATAGCATCTCCTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-248s1c1
Sequence:CCGGGCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-1137s1c1
Sequence:CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002004.2-843s1c1
Sequence:CCGGGCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002004.2-348s1c1
Sequence:CCGGGTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002004
VALIDATED
FDPS MISSION shRNA shRNA Plasmid DNA
farnesyl diphosphate synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-1348s21c1
Sequence:CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-522s21c1
Sequence:CCGGCCCAGAGATAGGAGATGCTATCTCGAGATAGCATCTCCTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-459s21c1
Sequence:CCGGGCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-1054s21c1
Sequence:CCGGGCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-559s21c1
Sequence:CCGGGTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-311s1c1
Sequence:CCGGCCCAGAGATAGGAGATGCTATCTCGAGATAGCATCTCCTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-248s1c1
Sequence:CCGGGCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-1137s1c1
Sequence:CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002004.2-843s1c1
Sequence:CCGGGCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002004.2-348s1c1
Sequence:CCGGGTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002004
VALIDATED
FDPS MISSION shRNA Lentiviral Transduction Particles
farnesyl diphosphate synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-1348s21c1
Sequence:CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-522s21c1
Sequence:CCGGCCCAGAGATAGGAGATGCTATCTCGAGATAGCATCTCCTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-459s21c1
Sequence:CCGGGCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-1054s21c1
Sequence:CCGGGCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002004.3-559s21c1
Sequence:CCGGGTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-311s1c1
Sequence:CCGGCCCAGAGATAGGAGATGCTATCTCGAGATAGCATCTCCTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-248s1c1
Sequence:CCGGGCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_002004.2-1137s1c1
Sequence:CCGGCCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002004.2-843s1c1
Sequence:CCGGGCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002004.2-348s1c1
Sequence:CCGGGTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks