EMAIL THIS PAGE TO A FRIEND

FDX1

ferredoxin 1

54 Gene Product Result for
Synonyms: ADX FDX LOH11CR1D
UniProtKB ID: P10109, B0YJ14, Q53YD6
Gene ID:
Human(2230) Summary: This gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism. Pseudogenes of this functional gene are found on chromosomes 20 and 21. [provided by RefSeq, Aug 2011]
Mouse(14148) ferredoxin 1
Rat(29189) ferredoxin 1
Zebrafish(100126232) ferredoxin 1
chicken(373947) ferredoxin 1
cow(281157) ferredoxin 1
dog(100686950) ferredoxin 1
sheep(101106360) ferredoxin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004109 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004109 Rosetta Predictions human pricing
NM_017126 Rosetta Predictions rat pricing
NM_007996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065430 predicted 655
2 SASI_Hs01_00065432 predicted 696
3 SASI_Hs01_00065434 predicted 656
4 SASI_Hs01_00065435 predicted 500
5 SASI_Hs01_00065436 predicted 790
6 SASI_Hs01_00065437 predicted 516
7 SASI_Hs02_00336933 predicted 699
8 SASI_Hs01_00065439 predicted 470
9 SASI_Hs02_00336934 predicted 693
10 SASI_Hs02_00336935 predicted 760
11 SASI_Hs01_00065431 predicted 600
12 SASI_Hs01_00065433 predicted 624
13 SASI_Hs01_00065438 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038627 predicted 272
2 SASI_Rn01_00038628 predicted 325
3 SASI_Rn01_00038629 predicted 449
4 SASI_Rn01_00038630 predicted 423
5 SASI_Rn01_00038631 predicted 286
6 SASI_Rn01_00038632 predicted 533
7 SASI_Rn01_00038633 predicted 363
8 SASI_Rn01_00038634 predicted 370
9 SASI_Rn01_00038635 predicted 334
10 SASI_Rn01_00038636 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057017 predicted 296
2 SASI_Mm01_00057018 predicted 404
3 SASI_Mm01_00057019 predicted 330
4 SASI_Mm01_00057020 predicted 263
5 SASI_Mm01_00057021 predicted 450
6 SASI_Mm01_00057022 predicted 403
7 SASI_Mm01_00057023 predicted 587
8 SASI_Mm01_00057025 predicted 537
9 SASI_Mm01_00057026 predicted 407
10 SASI_Mm02_00312921 predicted 515
11 SASI_Mm01_00057024 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007996
VALIDATED
FDX1 MISSION shRNA Bacterial Glycerol Stock
ferredoxin 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-258s1c1
Sequence:CCGGGAGCAGCTCAGAAGATAAGATCTCGAGATCTTATCTTCTGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-352s1c1
Sequence:CCGGGTTGTGATTGAGAACAACTTACTCGAGTAAGTTGTTCTCAATCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-442s1c1
Sequence:CCGGCACATCTATGAGAAGTTAGATCTCGAGATCTAACTTCTCATAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-413s1c1
Sequence:CCGGGCTCTACTTGTCATCTTATCTCTCGAGAGATAAGATGACAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-439s1c1
Sequence:CCGGGATCACATCTATGAGAAGTTACTCGAGTAACTTCTCATAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-546s1c1
Sequence:CCGGGACCAAGGCTATGGACAATATCTCGAGATATTGTCCATAGCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-355s1c1
Sequence:CCGGGTGATTGAGAACAACTTAGATCTCGAGATCTAAGTTGTTCTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-606s1c1
Sequence:CCGGGTCTGTTGACATGAGCAAGAACTCGAGTTCTTGCTCATGTCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007996.1-463s1c1
Sequence:CCGGGCCATTACTGATGAAGAGAATCTCGAGATTCTCTTCATCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-332s1c1
Sequence:CCGGTTGGCGACTCTCTGCTAGATGCTCGAGCATCTAGCAGAGAGTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-283s1c1
Sequence:CCGGGTCCACTTCAAGAACCGAGATCTCGAGATCTCGGTTCTTGAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007996
VALIDATED
FDX1 MISSION shRNA shRNA Plasmid DNA
ferredoxin 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-258s1c1
Sequence:CCGGGAGCAGCTCAGAAGATAAGATCTCGAGATCTTATCTTCTGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-352s1c1
Sequence:CCGGGTTGTGATTGAGAACAACTTACTCGAGTAAGTTGTTCTCAATCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-442s1c1
Sequence:CCGGCACATCTATGAGAAGTTAGATCTCGAGATCTAACTTCTCATAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-413s1c1
Sequence:CCGGGCTCTACTTGTCATCTTATCTCTCGAGAGATAAGATGACAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-439s1c1
Sequence:CCGGGATCACATCTATGAGAAGTTACTCGAGTAACTTCTCATAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-546s1c1
Sequence:CCGGGACCAAGGCTATGGACAATATCTCGAGATATTGTCCATAGCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-355s1c1
Sequence:CCGGGTGATTGAGAACAACTTAGATCTCGAGATCTAAGTTGTTCTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-606s1c1
Sequence:CCGGGTCTGTTGACATGAGCAAGAACTCGAGTTCTTGCTCATGTCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007996.1-463s1c1
Sequence:CCGGGCCATTACTGATGAAGAGAATCTCGAGATTCTCTTCATCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-332s1c1
Sequence:CCGGTTGGCGACTCTCTGCTAGATGCTCGAGCATCTAGCAGAGAGTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-283s1c1
Sequence:CCGGGTCCACTTCAAGAACCGAGATCTCGAGATCTCGGTTCTTGAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007996
VALIDATED
FDX1 MISSION shRNA Lentiviral Transduction Particles
ferredoxin 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-258s1c1
Sequence:CCGGGAGCAGCTCAGAAGATAAGATCTCGAGATCTTATCTTCTGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-352s1c1
Sequence:CCGGGTTGTGATTGAGAACAACTTACTCGAGTAAGTTGTTCTCAATCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-442s1c1
Sequence:CCGGCACATCTATGAGAAGTTAGATCTCGAGATCTAACTTCTCATAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-413s1c1
Sequence:CCGGGCTCTACTTGTCATCTTATCTCTCGAGAGATAAGATGACAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-439s1c1
Sequence:CCGGGATCACATCTATGAGAAGTTACTCGAGTAACTTCTCATAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-546s1c1
Sequence:CCGGGACCAAGGCTATGGACAATATCTCGAGATATTGTCCATAGCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007996.1-355s1c1
Sequence:CCGGGTGATTGAGAACAACTTAGATCTCGAGATCTAAGTTGTTCTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-606s1c1
Sequence:CCGGGTCTGTTGACATGAGCAAGAACTCGAGTTCTTGCTCATGTCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007996.1-463s1c1
Sequence:CCGGGCCATTACTGATGAAGAGAATCTCGAGATTCTCTTCATCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-332s1c1
Sequence:CCGGTTGGCGACTCTCTGCTAGATGCTCGAGCATCTAGCAGAGAGTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007996.1-283s1c1
Sequence:CCGGGTCCACTTCAAGAACCGAGATCTCGAGATCTCGGTTCTTGAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004109
VALIDATED
FDX1 MISSION shRNA Bacterial Glycerol Stock
ferredoxin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-456s1c1
Sequence:CCGGGTCCACTTTATAAACCGTGATCTCGAGATCACGGTTTATAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004109.3-768s1c1
Sequence:CCGGGATGCCAGACAATCCATTGATCTCGAGATCAATGGATTGTCTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-636s1c1
Sequence:CCGGGCAATCACTGATGAGGAGAATCTCGAGATTCTCCTCATCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004109.3-703s1c1
Sequence:CCGGGCTGCCAAATCTGTTTGACAACTCGAGTTGTCAAACAGATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-476s1c1
Sequence:CCGGTGGTGAAACATTAACAACCAACTCGAGTTGGTTGTTAATGTTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-636s21c1
Sequence:CCGGGCAATCACTGATGAGGAGAATCTCGAGATTCTCCTCATCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-703s21c1
Sequence:CCGGGCTGCCAAATCTGTTTGACAACTCGAGTTGTCAAACAGATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-476s21c1
Sequence:CCGGTGGTGAAACATTAACAACCAACTCGAGTTGGTTGTTAATGTTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-456s21c1
Sequence:CCGGGTCCACTTTATAAACCGTGATCTCGAGATCACGGTTTATAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004109
VALIDATED
FDX1 MISSION shRNA shRNA Plasmid DNA
ferredoxin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-456s1c1
Sequence:CCGGGTCCACTTTATAAACCGTGATCTCGAGATCACGGTTTATAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004109.3-768s1c1
Sequence:CCGGGATGCCAGACAATCCATTGATCTCGAGATCAATGGATTGTCTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-636s1c1
Sequence:CCGGGCAATCACTGATGAGGAGAATCTCGAGATTCTCCTCATCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004109.3-703s1c1
Sequence:CCGGGCTGCCAAATCTGTTTGACAACTCGAGTTGTCAAACAGATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-476s1c1
Sequence:CCGGTGGTGAAACATTAACAACCAACTCGAGTTGGTTGTTAATGTTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-636s21c1
Sequence:CCGGGCAATCACTGATGAGGAGAATCTCGAGATTCTCCTCATCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-703s21c1
Sequence:CCGGGCTGCCAAATCTGTTTGACAACTCGAGTTGTCAAACAGATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-476s21c1
Sequence:CCGGTGGTGAAACATTAACAACCAACTCGAGTTGGTTGTTAATGTTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-456s21c1
Sequence:CCGGGTCCACTTTATAAACCGTGATCTCGAGATCACGGTTTATAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004109
VALIDATED
FDX1 MISSION shRNA Lentiviral Transduction Particles
ferredoxin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-456s1c1
Sequence:CCGGGTCCACTTTATAAACCGTGATCTCGAGATCACGGTTTATAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004109.3-768s1c1
Sequence:CCGGGATGCCAGACAATCCATTGATCTCGAGATCAATGGATTGTCTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-636s1c1
Sequence:CCGGGCAATCACTGATGAGGAGAATCTCGAGATTCTCCTCATCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004109.3-703s1c1
Sequence:CCGGGCTGCCAAATCTGTTTGACAACTCGAGTTGTCAAACAGATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004109.3-476s1c1
Sequence:CCGGTGGTGAAACATTAACAACCAACTCGAGTTGGTTGTTAATGTTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-636s21c1
Sequence:CCGGGCAATCACTGATGAGGAGAATCTCGAGATTCTCCTCATCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-703s21c1
Sequence:CCGGGCTGCCAAATCTGTTTGACAACTCGAGTTGTCAAACAGATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-476s21c1
Sequence:CCGGTGGTGAAACATTAACAACCAACTCGAGTTGGTTGTTAATGTTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004109.3-456s21c1
Sequence:CCGGGTCCACTTTATAAACCGTGATCTCGAGATCACGGTTTATAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks