EMAIL THIS PAGE TO A FRIEND

FDX1L

ferredoxin 1-like

Synonyms: FDX2
UniProtKB ID: Q6P4F2
Gene ID:
Mouse(68165) ferredoxin 1-like
Rat(313786) ferredoxin 1-like
Zebrafish(767726) ferredoxin 1-like
dog(484957) ferredoxin 1-like
domestic cat(101089923) ferredoxin 1-like
cow(505159) ferredoxin 1-like
domestic guinea pig(100714981) ferredoxin 1-like
naked mole-rat(101714715) ferredoxin 1-like
sheep(101112813) ferredoxin 1-like
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043986 Anti-FDX1L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031734 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU211841 MISSION® esiRNA esiRNA targeting mouse Fdx1l mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031734 Rosetta Predictions human pricing
NM_080665 Rosetta Predictions human pricing
NM_001108002 Rosetta Predictions rat pricing
NM_001039824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030059 predicted 498
2 SASI_Hs01_00030061 predicted 403
3 SASI_Hs01_00030062 predicted 612
4 SASI_Hs01_00030063 predicted 525
5 SASI_Hs01_00030064 predicted 513
6 SASI_Hs01_00030065 predicted 496
7 SASI_Hs01_00030066 predicted 354
8 SASI_Hs01_00030067 predicted 578
9 SASI_Hs01_00030068 predicted 219
10 SASI_Hs02_00307793 predicted 561
11 SASI_Hs01_00030060 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131237 predicted 463
2 SASI_Hs01_00131238 predicted 572
3 SASI_Hs01_00131239 predicted 475
4 SASI_Hs01_00131240 predicted 358
5 SASI_Hs01_00131241 predicted 539
6 SASI_Hs01_00131242 predicted 355
7 SASI_Hs01_00131243 predicted 698
8 SASI_Hs01_00131244 predicted 721
9 SASI_Hs01_00131245 predicted 720
10 SASI_Hs01_00131246 predicted 143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234395 predicted 503
2 SASI_Rn02_00234396 predicted 484
3 SASI_Rn02_00234397 predicted 492
4 SASI_Rn02_00234398 predicted 483
5 SASI_Rn02_00234399 predicted 459
6 SASI_Rn02_00234400 predicted 371
7 SASI_Rn02_00234401 predicted 467
8 SASI_Rn02_00234402 predicted 311
9 SASI_Rn02_00234403 predicted 213
10 SASI_Rn02_00234404 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140337 predicted 308
2 SASI_Mm01_00140338 predicted 452
3 SASI_Mm01_00140339 predicted 448
4 SASI_Mm01_00140340 predicted 544
5 SASI_Mm01_00140341 predicted 442
6 SASI_Mm01_00140342 predicted 308
7 SASI_Mm02_00290240 predicted 487
8 SASI_Mm01_00140343 predicted 314
9 SASI_Mm01_00140344 predicted 522
10 SASI_Mm01_00140345 predicted 543
11 SASI_Mm01_00140346 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039824
VALIDATED
FDX1L MISSION shRNA Bacterial Glycerol Stock
ferredoxin 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-313s21c1
Sequence:CCGGGTTCCACCTGTCATGTGTATGCTCGAGCATACACATGACAGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-453s21c1
Sequence:CCGGGAGCTAGAGGGAGTTGAATTTCTCGAGAAATTCAACTCCCTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-484s21c1
Sequence:CCGGAGATCACCAGGAACTTCTATGCTCGAGCATAGAAGTTCCTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-608s21c1
Sequence:CCGGCCCAGGAAAGAGAAGTTGGACCTCGAGGTCCAACTTCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-96s21c1
Sequence:CCGGGCGGTAACATCTAGGACGTTCCTCGAGGAACGTCCTAGATGTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039824
VALIDATED
FDX1L MISSION shRNA shRNA Plasmid DNA
ferredoxin 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-313s21c1
Sequence:CCGGGTTCCACCTGTCATGTGTATGCTCGAGCATACACATGACAGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-453s21c1
Sequence:CCGGGAGCTAGAGGGAGTTGAATTTCTCGAGAAATTCAACTCCCTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-484s21c1
Sequence:CCGGAGATCACCAGGAACTTCTATGCTCGAGCATAGAAGTTCCTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-608s21c1
Sequence:CCGGCCCAGGAAAGAGAAGTTGGACCTCGAGGTCCAACTTCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-96s21c1
Sequence:CCGGGCGGTAACATCTAGGACGTTCCTCGAGGAACGTCCTAGATGTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039824
VALIDATED
FDX1L MISSION shRNA Lentiviral Transduction Particles
ferredoxin 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-313s21c1
Sequence:CCGGGTTCCACCTGTCATGTGTATGCTCGAGCATACACATGACAGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-453s21c1
Sequence:CCGGGAGCTAGAGGGAGTTGAATTTCTCGAGAAATTCAACTCCCTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-484s21c1
Sequence:CCGGAGATCACCAGGAACTTCTATGCTCGAGCATAGAAGTTCCTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-608s21c1
Sequence:CCGGCCCAGGAAAGAGAAGTTGGACCTCGAGGTCCAACTTCTCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039824.2-96s21c1
Sequence:CCGGGCGGTAACATCTAGGACGTTCCTCGAGGAACGTCCTAGATGTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031734
FDX1L MISSION shRNA Bacterial Glycerol Stock
ferredoxin 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031734.2-578s21c1
Sequence:CCGGCACCTGGACCATTCCACATTGCTCGAGCAATGTGGAATGGTCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-359s21c1
Sequence:CCGGTGCCATGTGTATGTGAGTGAACTCGAGTTCACTCACATACACATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-221s21c1
Sequence:CCGGGTGAACGTGGTGTTCGTAGACCTCGAGGTCTACGAACACCACGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-519s21c1
Sequence:CCGGCCAAGATCACCAGGAACTTCTCTCGAGAGAAGTTCCTGGTGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-416s21c1
Sequence:CCGGGAAGACGACATGCTAGACATGCTCGAGCATGTCTAGCATGTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031734
FDX1L MISSION shRNA shRNA Plasmid DNA
ferredoxin 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031734.2-578s21c1
Sequence:CCGGCACCTGGACCATTCCACATTGCTCGAGCAATGTGGAATGGTCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-359s21c1
Sequence:CCGGTGCCATGTGTATGTGAGTGAACTCGAGTTCACTCACATACACATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-221s21c1
Sequence:CCGGGTGAACGTGGTGTTCGTAGACCTCGAGGTCTACGAACACCACGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-519s21c1
Sequence:CCGGCCAAGATCACCAGGAACTTCTCTCGAGAGAAGTTCCTGGTGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-416s21c1
Sequence:CCGGGAAGACGACATGCTAGACATGCTCGAGCATGTCTAGCATGTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031734
FDX1L MISSION shRNA Lentiviral Transduction Particles
ferredoxin 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031734.2-578s21c1
Sequence:CCGGCACCTGGACCATTCCACATTGCTCGAGCAATGTGGAATGGTCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-359s21c1
Sequence:CCGGTGCCATGTGTATGTGAGTGAACTCGAGTTCACTCACATACACATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-221s21c1
Sequence:CCGGGTGAACGTGGTGTTCGTAGACCTCGAGGTCTACGAACACCACGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-519s21c1
Sequence:CCGGCCAAGATCACCAGGAACTTCTCTCGAGAGAAGTTCCTGGTGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031734.2-416s21c1
Sequence:CCGGGAAGACGACATGCTAGACATGCTCGAGCATGTCTAGCATGTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080665
VALIDATED
FDX1L MISSION shRNA Bacterial Glycerol Stock
ferredoxin 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-142s1c1
Sequence:CCGGGAAAGTTTCAAGCGACAGGCTCTCGAGAGCCTGTCGCTTGAAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_080665.3-222s1c1
Sequence:CCGGGTGGTGTTCGTAGACCGCTCACTCGAGTGAGCGGTCTACGAACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_080665.3-366s1c1
Sequence:CCGGGTGAGTGAAGACCACCTGGATCTCGAGATCCAGGTGGTCTTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-344s1c1
Sequence:CCGGCTGCTCCACCTGCCATGTGTACTCGAGTACACATGGCAGGTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-41s1c1
Sequence:CCGGCGTGAGTGCCAGGGTTCTACTCTCGAGAGTAGAACCCTGGCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080665
VALIDATED
FDX1L MISSION shRNA shRNA Plasmid DNA
ferredoxin 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-142s1c1
Sequence:CCGGGAAAGTTTCAAGCGACAGGCTCTCGAGAGCCTGTCGCTTGAAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_080665.3-222s1c1
Sequence:CCGGGTGGTGTTCGTAGACCGCTCACTCGAGTGAGCGGTCTACGAACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_080665.3-366s1c1
Sequence:CCGGGTGAGTGAAGACCACCTGGATCTCGAGATCCAGGTGGTCTTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-344s1c1
Sequence:CCGGCTGCTCCACCTGCCATGTGTACTCGAGTACACATGGCAGGTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-41s1c1
Sequence:CCGGCGTGAGTGCCAGGGTTCTACTCTCGAGAGTAGAACCCTGGCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080665
VALIDATED
FDX1L MISSION shRNA Lentiviral Transduction Particles
ferredoxin 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-142s1c1
Sequence:CCGGGAAAGTTTCAAGCGACAGGCTCTCGAGAGCCTGTCGCTTGAAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_080665.3-222s1c1
Sequence:CCGGGTGGTGTTCGTAGACCGCTCACTCGAGTGAGCGGTCTACGAACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_080665.3-366s1c1
Sequence:CCGGGTGAGTGAAGACCACCTGGATCTCGAGATCCAGGTGGTCTTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-344s1c1
Sequence:CCGGCTGCTCCACCTGCCATGTGTACTCGAGTACACATGGCAGGTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080665.3-41s1c1
Sequence:CCGGCGTGAGTGCCAGGGTTCTACTCTCGAGAGTAGAACCCTGGCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks