EMAIL THIS PAGE TO A FRIEND

FDXACB1

ferredoxin-fold anticodon binding domain containing 1

45 Gene Product Result for
UniProtKB ID: Q9BRP7, A0PJW7
Gene ID:
Human(91893) Summary: This gene encodes a protein which contains a ferredoxin-fold anticodon-binding domain which is contained in a subset of phenylalanyl tRNA synthetases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(382137) ferredoxin-fold anticodon binding domain containing 1
Rat(315646) ferredoxin-fold anticodon binding domain containing 1
chicken(419800) ferredoxin-fold anticodon binding domain containing 1
cow(100847683) ferredoxin-fold anticodon binding domain containing 1
domestic cat(101092394) ferredoxin-fold anticodon binding domain containing 1
Horse(100070429) ferredoxin-fold anticodon binding domain containing 1
dog(489408) ferredoxin-fold anticodon binding domain containing 1
sheep(101109734) ferredoxin-fold anticodon binding domain containing 1
naked mole-rat(101725198) ferredoxin-fold anticodon binding domain containing 1
domestic guinea pig(100712935) ferredoxin-fold anticodon binding domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138378 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138378 Rosetta Predictions human pricing
NM_001108145 Rosetta Predictions rat pricing
NM_198675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363495 predicted 1894
2 SASI_Hs02_00363496 predicted 1028
3 SASI_Hs02_00363497 predicted 704
4 SASI_Hs02_00363498 predicted 830
5 SASI_Hs02_00363499 predicted 805
6 SASI_Hs02_00363500 predicted 857
7 SASI_Hs02_00363501 predicted 774
8 SASI_Hs02_00363502 predicted 1936
9 SASI_Hs02_00363503 predicted 1174
10 SASI_Hs02_00363504 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235804 predicted 1018
2 SASI_Rn02_00235805 predicted 1243
3 SASI_Rn02_00235806 predicted 1209
4 SASI_Rn02_00235807 predicted 1526
5 SASI_Rn02_00235808 predicted 957
6 SASI_Rn02_00235809 predicted 1177
7 SASI_Rn02_00235810 predicted 1311
8 SASI_Rn02_00235811 predicted 731
9 SASI_Rn02_00235812 predicted 1429
10 SASI_Rn02_00235813 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200850 predicted 1445
2 SASI_Mm01_00200851 predicted 1632
3 SASI_Mm02_00351151 predicted 1216
4 SASI_Mm02_00351152 predicted 1197
5 SASI_Mm01_00200852 predicted 759
6 SASI_Mm01_00200853 predicted 1458
7 SASI_Mm01_00200855 predicted 1392
8 SASI_Mm01_00200856 predicted 1425
9 SASI_Mm02_00351153 predicted 1675
10 SASI_Mm01_00200857 predicted 556
11 SASI_Mm01_00200854 predicted 1189
12 SASI_Mm01_00200858 predicted 1420
13 SASI_Mm01_00200859 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198675
FDXACB1 MISSION shRNA Bacterial Glycerol Stock
ferredoxin-fold anticodon binding domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.1-1971s1c1
Sequence:CCGGGATTGTGCTGAGAATCTGATTCTCGAGAATCAGATTCTCAGCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.1-1754s1c1
Sequence:CCGGGCCAGCATTTCACGAGACTTTCTCGAGAAAGTCTCGTGAAATGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1369s21c1
Sequence:CCGGACCAAACGGAAAGGATTATATCTCGAGATATAATCCTTTCCGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.2-1523s1c1
Sequence:CCGGGTTATGCTTGCCTATGGTATTCTCGAGAATACCATAGGCAAGCATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.2-785s1c1
Sequence:CCGGGAGAAACTCATTGCCGAATTGCTCGAGCAATTCGGCAATGAGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1525s21c1
Sequence:CCGGTATGCTTGCCTATGGTATTTCCTCGAGGAAATACCATAGGCAAGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1479s21c1
Sequence:CCGGAGCATCAGTGTTTCGTGTTTGCTCGAGCAAACACGAAACACTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-604s21c1
Sequence:CCGGAGAAGGTGCTTTGACCTATATCTCGAGATATAGGTCAAAGCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1646s21c1
Sequence:CCGGTATGTGCATGACGTTAGTTTCCTCGAGGAAACTAACGTCATGCACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198675
FDXACB1 MISSION shRNA shRNA Plasmid DNA
ferredoxin-fold anticodon binding domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.1-1971s1c1
Sequence:CCGGGATTGTGCTGAGAATCTGATTCTCGAGAATCAGATTCTCAGCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.1-1754s1c1
Sequence:CCGGGCCAGCATTTCACGAGACTTTCTCGAGAAAGTCTCGTGAAATGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1369s21c1
Sequence:CCGGACCAAACGGAAAGGATTATATCTCGAGATATAATCCTTTCCGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.2-1523s1c1
Sequence:CCGGGTTATGCTTGCCTATGGTATTCTCGAGAATACCATAGGCAAGCATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.2-785s1c1
Sequence:CCGGGAGAAACTCATTGCCGAATTGCTCGAGCAATTCGGCAATGAGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1525s21c1
Sequence:CCGGTATGCTTGCCTATGGTATTTCCTCGAGGAAATACCATAGGCAAGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1479s21c1
Sequence:CCGGAGCATCAGTGTTTCGTGTTTGCTCGAGCAAACACGAAACACTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-604s21c1
Sequence:CCGGAGAAGGTGCTTTGACCTATATCTCGAGATATAGGTCAAAGCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1646s21c1
Sequence:CCGGTATGTGCATGACGTTAGTTTCCTCGAGGAAACTAACGTCATGCACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198675
FDXACB1 MISSION shRNA Lentiviral Transduction Particles
ferredoxin-fold anticodon binding domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.1-1971s1c1
Sequence:CCGGGATTGTGCTGAGAATCTGATTCTCGAGAATCAGATTCTCAGCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.1-1754s1c1
Sequence:CCGGGCCAGCATTTCACGAGACTTTCTCGAGAAAGTCTCGTGAAATGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1369s21c1
Sequence:CCGGACCAAACGGAAAGGATTATATCTCGAGATATAATCCTTTCCGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.2-1523s1c1
Sequence:CCGGGTTATGCTTGCCTATGGTATTCTCGAGAATACCATAGGCAAGCATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198675.2-785s1c1
Sequence:CCGGGAGAAACTCATTGCCGAATTGCTCGAGCAATTCGGCAATGAGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1525s21c1
Sequence:CCGGTATGCTTGCCTATGGTATTTCCTCGAGGAAATACCATAGGCAAGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1479s21c1
Sequence:CCGGAGCATCAGTGTTTCGTGTTTGCTCGAGCAAACACGAAACACTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-604s21c1
Sequence:CCGGAGAAGGTGCTTTGACCTATATCTCGAGATATAGGTCAAAGCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198675.2-1646s21c1
Sequence:CCGGTATGTGCATGACGTTAGTTTCCTCGAGGAAACTAACGTCATGCACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138378
FDXACB1 MISSION shRNA Bacterial Glycerol Stock
ferredoxin-fold anticodon binding domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-1674s21c1
Sequence:CCGGAGATTGTACTGAGGATCTAATCTCGAGATTAGATCCTCAGTACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-1623s21c1
Sequence:CCGGGTCAAATGGAAAGGATTATATCTCGAGATATAATCCTTTCCATTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-2137s21c1
Sequence:CCGGGAGATTCAACAACACCTATATCTCGAGATATAGGTGTTGTTGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138378.1-2383s21c1
Sequence:CCGGATGATATCAGCTCACTATAAGCTCGAGCTTATAGTGAGCTGATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-810s21c1
Sequence:CCGGGTACAAGTGCACTGGATATAGCTCGAGCTATATCCAGTGCACTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138378
FDXACB1 MISSION shRNA shRNA Plasmid DNA
ferredoxin-fold anticodon binding domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-1674s21c1
Sequence:CCGGAGATTGTACTGAGGATCTAATCTCGAGATTAGATCCTCAGTACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-1623s21c1
Sequence:CCGGGTCAAATGGAAAGGATTATATCTCGAGATATAATCCTTTCCATTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-2137s21c1
Sequence:CCGGGAGATTCAACAACACCTATATCTCGAGATATAGGTGTTGTTGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138378.1-2383s21c1
Sequence:CCGGATGATATCAGCTCACTATAAGCTCGAGCTTATAGTGAGCTGATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-810s21c1
Sequence:CCGGGTACAAGTGCACTGGATATAGCTCGAGCTATATCCAGTGCACTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138378
FDXACB1 MISSION shRNA Lentiviral Transduction Particles
ferredoxin-fold anticodon binding domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-1674s21c1
Sequence:CCGGAGATTGTACTGAGGATCTAATCTCGAGATTAGATCCTCAGTACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-1623s21c1
Sequence:CCGGGTCAAATGGAAAGGATTATATCTCGAGATATAATCCTTTCCATTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-2137s21c1
Sequence:CCGGGAGATTCAACAACACCTATATCTCGAGATATAGGTGTTGTTGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138378.1-2383s21c1
Sequence:CCGGATGATATCAGCTCACTATAAGCTCGAGCTTATAGTGAGCTGATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138378.1-810s21c1
Sequence:CCGGGTACAAGTGCACTGGATATAGCTCGAGCTATATCCAGTGCACTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)