EMAIL THIS PAGE TO A FRIEND

FDXR

ferredoxin reductase

109 Gene Product Result for
Synonyms: ADXR
Gene ID:
Human(2232) Summary: This gene encodes a mitochondrial flavoprotein that initiates electron transport for cytochromes P450 receiving electrons from NADPH. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(14149) ferredoxin reductase
Rat(79122) ferredoxin reductase
chicken(769635) ferredoxin reductase
domestic cat(101096022) ferredoxin reductase
cow(282604) ferredoxin reductase
Horse(100060312) ferredoxin reductase
dog(475910) ferredoxin reductase
domestic guinea pig(100721684) ferredoxin reductase
naked mole-rat(101700719) ferredoxin reductase
sheep(101111818) ferredoxin reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004110 Rosetta Predictions human pricing
NM_024417 Rosetta Predictions human pricing
NM_024153 Rosetta Predictions rat pricing
NM_007997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068167 predicted 299
2 SASI_Hs01_00068168 predicted 914
3 SASI_Hs02_00336936 predicted 941
4 SASI_Hs01_00068170 predicted 1303
5 SASI_Hs01_00068172 predicted 1244
6 SASI_Hs01_00068173 predicted 285
7 SASI_Hs01_00068174 predicted 1166
8 SASI_Hs01_00068175 predicted 1098
9 SASI_Hs02_00336937 predicted 1153
10 SASI_Hs02_00336938 predicted 924
11 SASI_Hs01_00068169 predicted 252
12 SASI_Hs01_00068171 predicted 257
13 SASI_Hs01_00068176 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170433 predicted 306
2 SASI_Hs01_00170434 predicted 898
3 SASI_Hs02_00356718 predicted 921
4 SASI_Hs01_00170436 predicted 1292
5 SASI_Hs01_00170438 predicted 1225
6 SASI_Hs01_00170439 predicted 291
7 SASI_Hs01_00170440 predicted 1151
8 SASI_Hs01_00170441 predicted 1078
9 SASI_Hs02_00356719 predicted 1136
10 SASI_Hs02_00356720 predicted 906
11 SASI_Hs01_00170435 predicted 244
12 SASI_Hs01_00170437 predicted 260
13 SASI_Hs01_00170442 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263883 predicted 724
2 SASI_Rn01_00081386 predicted 1451
3 SASI_Rn01_00081387 predicted 495
4 SASI_Rn01_00081388 predicted 219
5 SASI_Rn01_00081389 predicted 404
6 SASI_Rn01_00081390 predicted 584
7 SASI_Rn02_00263884 predicted 724
8 SASI_Rn01_00081392 predicted 1382
9 SASI_Rn01_00081394 predicted 881
10 SASI_Rn02_00263885 predicted 403
11 SASI_Rn01_00081385 predicted 1246
12 SASI_Rn01_00081391 predicted 480
13 SASI_Rn01_00081393 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201457 predicted 272
2 SASI_Mm01_00201458 predicted 1513
3 SASI_Mm01_00201459 predicted 244
4 SASI_Mm01_00201460 predicted 465
5 SASI_Mm01_00201461 predicted 605
6 SASI_Mm01_00201462 predicted 644
7 SASI_Mm01_00201463 predicted 552
8 SASI_Mm01_00201464 predicted 1157
9 SASI_Mm01_00201465 predicted 538
10 SASI_Mm01_00201466 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007997
VALIDATED
FDXR MISSION shRNA Bacterial Glycerol Stock
ferredoxin reductase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-1520s21c1
Sequence:CCGGGAGAAGCTGGTGGATCGAAGACTCGAGTCTTCGATCCACCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-1158s21c1
Sequence:CCGGTGCTGAGCAGCGTTGGGTATACTCGAGTATACCCAACGCTGCTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-872s21c1
Sequence:CCGGGGCCTCCAGGACAGAATTAAGCTCGAGCTTAATTCTGTCCTGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-558s21c1
Sequence:CCGGCCTTTGTGGGCTGGTACAATGCTCGAGCATTGTACCAGCCCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007997.1-339s1c1
Sequence:CCGGCACCTGACCATCCTGAAGTAACTCGAGTTACTTCAGGATGGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007997.1-1497s1c1
Sequence:CCGGGCCAAGGTACTGGGAAACCAACTCGAGTTGGTTTCCCAGTACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007997.1-1620s1c1
Sequence:CCGGGACTCTTCTCTCGTTCATTATCTCGAGATAATGAACGAGAGAAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007997.1-280s1c1
Sequence:CCGGCCACGTAGACATCTACGAGAACTCGAGTTCTCGTAGATGTCTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007997.1-794s1c1
Sequence:CCGGGCGTTCACCATTAAGGAGCTTCTCGAGAAGCTCCTTAATGGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007997
VALIDATED
FDXR MISSION shRNA shRNA Plasmid DNA
ferredoxin reductase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-1520s21c1
Sequence:CCGGGAGAAGCTGGTGGATCGAAGACTCGAGTCTTCGATCCACCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-1158s21c1
Sequence:CCGGTGCTGAGCAGCGTTGGGTATACTCGAGTATACCCAACGCTGCTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-872s21c1
Sequence:CCGGGGCCTCCAGGACAGAATTAAGCTCGAGCTTAATTCTGTCCTGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-558s21c1
Sequence:CCGGCCTTTGTGGGCTGGTACAATGCTCGAGCATTGTACCAGCCCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007997.1-339s1c1
Sequence:CCGGCACCTGACCATCCTGAAGTAACTCGAGTTACTTCAGGATGGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007997.1-1497s1c1
Sequence:CCGGGCCAAGGTACTGGGAAACCAACTCGAGTTGGTTTCCCAGTACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007997.1-1620s1c1
Sequence:CCGGGACTCTTCTCTCGTTCATTATCTCGAGATAATGAACGAGAGAAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007997.1-280s1c1
Sequence:CCGGCCACGTAGACATCTACGAGAACTCGAGTTCTCGTAGATGTCTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007997.1-794s1c1
Sequence:CCGGGCGTTCACCATTAAGGAGCTTCTCGAGAAGCTCCTTAATGGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007997
VALIDATED
FDXR MISSION shRNA Lentiviral Transduction Particles
ferredoxin reductase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-1520s21c1
Sequence:CCGGGAGAAGCTGGTGGATCGAAGACTCGAGTCTTCGATCCACCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-1158s21c1
Sequence:CCGGTGCTGAGCAGCGTTGGGTATACTCGAGTATACCCAACGCTGCTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-872s21c1
Sequence:CCGGGGCCTCCAGGACAGAATTAAGCTCGAGCTTAATTCTGTCCTGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007997.1-558s21c1
Sequence:CCGGCCTTTGTGGGCTGGTACAATGCTCGAGCATTGTACCAGCCCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007997.1-339s1c1
Sequence:CCGGCACCTGACCATCCTGAAGTAACTCGAGTTACTTCAGGATGGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007997.1-1497s1c1
Sequence:CCGGGCCAAGGTACTGGGAAACCAACTCGAGTTGGTTTCCCAGTACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007997.1-1620s1c1
Sequence:CCGGGACTCTTCTCTCGTTCATTATCTCGAGATAATGAACGAGAGAAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007997.1-280s1c1
Sequence:CCGGCCACGTAGACATCTACGAGAACTCGAGTTCTCGTAGATGTCTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007997.1-794s1c1
Sequence:CCGGGCGTTCACCATTAAGGAGCTTCTCGAGAAGCTCCTTAATGGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024417
VALIDATED
FDXR MISSION shRNA Bacterial Glycerol Stock
ferredoxin reductase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-1078s21c1
Sequence:CCGGACTAGACTGGAGGGTGTCGATCTCGAGATCGACACCCTCCAGTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024417.2-1746s21c1
Sequence:CCGGAGCTTTCAGCAACTGAGGTAACTCGAGTTACCTCAGTTGCTGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-847s21c1
Sequence:CCGGTTGGATCCTGTGGATTTCTTGCTCGAGCAAGAAATCCACAGGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-372s21c1
Sequence:CCGGATTTACCCAGACGGCCCATTCCTCGAGGAATGGGCCGTCTGGGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-731s1c1
Sequence:CCGGGCCTTCACCATTAAGGAGCTTCTCGAGAAGCTCCTTAATGGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-748s1c1
Sequence:CCGGGCTTCGGGAGATGATTCAGTTCTCGAGAACTGAATCATCTCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024417.1-103s1c1
Sequence:CCGGCCCGAGCTTCTGCCACCATTTCTCGAGAAATGGTGGCAGAAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_024417.1-118s1c1
Sequence:CCGGCCATTTCTCCACACAGGAGAACTCGAGTTCTCCTGTGTGGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-1096s1c1
Sequence:CCGGGCTCAGCAGCATTGGGTATAACTCGAGTTATACCCAATGCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024417
VALIDATED
FDXR MISSION shRNA shRNA Plasmid DNA
ferredoxin reductase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-1078s21c1
Sequence:CCGGACTAGACTGGAGGGTGTCGATCTCGAGATCGACACCCTCCAGTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024417.2-1746s21c1
Sequence:CCGGAGCTTTCAGCAACTGAGGTAACTCGAGTTACCTCAGTTGCTGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-847s21c1
Sequence:CCGGTTGGATCCTGTGGATTTCTTGCTCGAGCAAGAAATCCACAGGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-372s21c1
Sequence:CCGGATTTACCCAGACGGCCCATTCCTCGAGGAATGGGCCGTCTGGGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-731s1c1
Sequence:CCGGGCCTTCACCATTAAGGAGCTTCTCGAGAAGCTCCTTAATGGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-748s1c1
Sequence:CCGGGCTTCGGGAGATGATTCAGTTCTCGAGAACTGAATCATCTCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024417.1-103s1c1
Sequence:CCGGCCCGAGCTTCTGCCACCATTTCTCGAGAAATGGTGGCAGAAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_024417.1-118s1c1
Sequence:CCGGCCATTTCTCCACACAGGAGAACTCGAGTTCTCCTGTGTGGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-1096s1c1
Sequence:CCGGGCTCAGCAGCATTGGGTATAACTCGAGTTATACCCAATGCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024417
VALIDATED
FDXR MISSION shRNA Lentiviral Transduction Particles
ferredoxin reductase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-1078s21c1
Sequence:CCGGACTAGACTGGAGGGTGTCGATCTCGAGATCGACACCCTCCAGTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024417.2-1746s21c1
Sequence:CCGGAGCTTTCAGCAACTGAGGTAACTCGAGTTACCTCAGTTGCTGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-847s21c1
Sequence:CCGGTTGGATCCTGTGGATTTCTTGCTCGAGCAAGAAATCCACAGGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024417.2-372s21c1
Sequence:CCGGATTTACCCAGACGGCCCATTCCTCGAGGAATGGGCCGTCTGGGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-731s1c1
Sequence:CCGGGCCTTCACCATTAAGGAGCTTCTCGAGAAGCTCCTTAATGGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-748s1c1
Sequence:CCGGGCTTCGGGAGATGATTCAGTTCTCGAGAACTGAATCATCTCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024417.1-103s1c1
Sequence:CCGGCCCGAGCTTCTGCCACCATTTCTCGAGAAATGGTGGCAGAAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_024417.1-118s1c1
Sequence:CCGGCCATTTCTCCACACAGGAGAACTCGAGTTCTCCTGTGTGGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024417.1-1096s1c1
Sequence:CCGGGCTCAGCAGCATTGGGTATAACTCGAGTTATACCCAATGCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks