EMAIL THIS PAGE TO A FRIEND

FECH

ferrochelatase

75 Gene Product Result for
Synonyms: EPP FCE
UniProtKB ID: P22830, A8KA72, Q8IXN1, Q8NAN0
Gene ID:
Human(2235) Summary: The protein encoded by this gene is localized to the mitochondrion, where it catalyzes the insertion of the ferrous form of iron into protoporphyrin IX in the heme synthesis pathway. Mutations in this gene are associated with erythropoietic protoporphyria. Two transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome 3.[provided by RefSeq, May 2010]
Mouse(14151) ferrochelatase
Rat(361338) ferrochelatase
sheep(101115248) ferrochelatase
naked mole-rat(101713398) ferrochelatase
Zebrafish(58215) ferrochelatase
dog(610360) ferrochelatase
cow(281158) ferrochelatase
cow(790571) ferrochelatase
domestic cat(101087879) ferrochelatase
chicken(374020) ferrochelatase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000140 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000140 Rosetta Predictions human pricing
NM_001012515 Rosetta Predictions human pricing
NM_001108434 Rosetta Predictions rat pricing
NM_007998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052189 predicted 1467
2 SASI_Hs01_00052190 predicted 684
3 SASI_Hs01_00052191 predicted 821
4 SASI_Hs01_00052192 predicted 843
5 SASI_Hs01_00052193 predicted 1369
6 SASI_Hs01_00052196 predicted 1086
7 SASI_Hs02_00301950 predicted 1497
8 SASI_Hs02_00301951 predicted 1111
9 SASI_Hs02_00301952 predicted 787
10 SASI_Hs02_00301953 predicted 1304
11 SASI_Hs01_00052188 predicted 1497
12 SASI_Hs01_00052194 predicted 1248
13 SASI_Hs01_00052195 predicted 1147
14 SASI_Hs01_00052197 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035567 predicted 1492
2 SASI_Hs01_00035568 predicted 704
3 SASI_Hs01_00035569 predicted 838
4 SASI_Hs01_00035570 predicted 859
5 SASI_Hs01_00035571 predicted 1387
6 SASI_Hs01_00035574 predicted 1101
7 SASI_Hs02_00306187 predicted 1516
8 SASI_Hs02_00306188 predicted 1135
9 SASI_Hs02_00306189 predicted 805
10 SASI_Hs02_00306190 predicted 1320
11 SASI_Hs01_00035566 predicted 1517
12 SASI_Hs01_00035572 predicted 1260
13 SASI_Hs01_00035573 predicted 1158
14 SASI_Hs01_00035575 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238599 predicted 1037
2 SASI_Rn02_00238600 predicted 298
3 SASI_Rn02_00238601 predicted 797
4 SASI_Rn02_00238602 predicted 847
5 SASI_Rn02_00238603 predicted 1113
6 SASI_Rn02_00238604 predicted 699
7 SASI_Rn02_00238605 predicted 1091
8 SASI_Rn02_00238606 predicted 809
9 SASI_Rn02_00238607 predicted 1182
10 SASI_Rn02_00238608 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066598 predicted 1040
2 SASI_Mm01_00066599 predicted 303
3 SASI_Mm02_00312922 predicted 796
4 SASI_Mm01_00066601 predicted 1033
5 SASI_Mm01_00066602 predicted 810
6 SASI_Mm01_00066605 predicted 1185
7 SASI_Mm01_00066606 predicted 1437
8 SASI_Mm02_00312923 predicted 1084
9 SASI_Mm02_00312924 predicted 1233
10 SASI_Mm02_00312925 predicted 1097
11 SASI_Mm01_00066600 predicted 1152
12 SASI_Mm01_00066603 predicted 1117
13 SASI_Mm01_00066604 predicted 698
14 SASI_Mm01_00066607 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007998
FECH MISSION shRNA Bacterial Glycerol Stock
ferrochelatase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007998.3-1755s1c1
Sequence:CCGGGCACACAAATTCTACACTTATCTCGAGATAAGTGTAGAATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1126s1c1
Sequence:CCGGGACGCTCTACGAACTGGATATCTCGAGATATCCAGTTCGTAGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1199s1c1
Sequence:CCGGGCGGAGTCTCTTAATGGAAATCTCGAGATTTCCATTAAGAGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-560s1c1
Sequence:CCGGGCACCTCACAAATACTATATTCTCGAGAATATAGTATTTGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1087s1c1
Sequence:CCGGCCTCTTGGTTCCAATAGCATTCTCGAGAATGCTATTGGAACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007998.6-1754s21c1
Sequence:CCGGGCACACAAATTCTACACTTATCTCGAGATAAGTGTAGAATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-559s21c1
Sequence:CCGGGCACCTCACAAATACTATATTCTCGAGAATATAGTATTTGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-1125s21c1
Sequence:CCGGGACGCTCTACGAACTGGATATCTCGAGATATCCAGTTCGTAGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-1086s21c1
Sequence:CCGGCCTCTTGGTTCCAATAGCATTCTCGAGAATGCTATTGGAACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007998
FECH MISSION shRNA shRNA Plasmid DNA
ferrochelatase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007998.3-1755s1c1
Sequence:CCGGGCACACAAATTCTACACTTATCTCGAGATAAGTGTAGAATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1126s1c1
Sequence:CCGGGACGCTCTACGAACTGGATATCTCGAGATATCCAGTTCGTAGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1199s1c1
Sequence:CCGGGCGGAGTCTCTTAATGGAAATCTCGAGATTTCCATTAAGAGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-560s1c1
Sequence:CCGGGCACCTCACAAATACTATATTCTCGAGAATATAGTATTTGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1087s1c1
Sequence:CCGGCCTCTTGGTTCCAATAGCATTCTCGAGAATGCTATTGGAACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007998.6-1754s21c1
Sequence:CCGGGCACACAAATTCTACACTTATCTCGAGATAAGTGTAGAATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-559s21c1
Sequence:CCGGGCACCTCACAAATACTATATTCTCGAGAATATAGTATTTGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-1125s21c1
Sequence:CCGGGACGCTCTACGAACTGGATATCTCGAGATATCCAGTTCGTAGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-1086s21c1
Sequence:CCGGCCTCTTGGTTCCAATAGCATTCTCGAGAATGCTATTGGAACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007998
FECH MISSION shRNA Lentiviral Transduction Particles
ferrochelatase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007998.3-1755s1c1
Sequence:CCGGGCACACAAATTCTACACTTATCTCGAGATAAGTGTAGAATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1126s1c1
Sequence:CCGGGACGCTCTACGAACTGGATATCTCGAGATATCCAGTTCGTAGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1199s1c1
Sequence:CCGGGCGGAGTCTCTTAATGGAAATCTCGAGATTTCCATTAAGAGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-560s1c1
Sequence:CCGGGCACCTCACAAATACTATATTCTCGAGAATATAGTATTTGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007998.3-1087s1c1
Sequence:CCGGCCTCTTGGTTCCAATAGCATTCTCGAGAATGCTATTGGAACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007998.6-1754s21c1
Sequence:CCGGGCACACAAATTCTACACTTATCTCGAGATAAGTGTAGAATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-559s21c1
Sequence:CCGGGCACCTCACAAATACTATATTCTCGAGAATATAGTATTTGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-1125s21c1
Sequence:CCGGGACGCTCTACGAACTGGATATCTCGAGATATCCAGTTCGTAGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007998.6-1086s21c1
Sequence:CCGGCCTCTTGGTTCCAATAGCATTCTCGAGAATGCTATTGGAACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000140
VALIDATED
FECH MISSION shRNA Bacterial Glycerol Stock
ferrochelatase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000140.1-736s1c1
Sequence:CCGGGCTTTGCAGATCATATTCTAACTCGAGTTAGAATATGATCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1262s1c1
Sequence:CCGGCAGGGAGACTAAATCCTTCTTCTCGAGAAGAAGGATTTAGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1047s1c1
Sequence:CCGGGACCATATTGAAACGCTGTATCTCGAGATACAGCGTTTCAATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1099s1c1
Sequence:CCGGCCAAGGAGTGTGGAGTTGAAACTCGAGTTTCAACTCCACACTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000140.3-824s21c1
Sequence:CCGGGCTTTGCAGATCATATTCTAACTCGAGTTAGAATATGATCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000140.3-1135s21c1
Sequence:CCGGGACCATATTGAAACGCTGTATCTCGAGATACAGCGTTTCAATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000140.3-670s21c1
Sequence:CCGGGCTATTGCTTTCACACAGTATCTCGAGATACTGTGTGAAAGCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000140.3-1350s21c1
Sequence:CCGGCAGGGAGACTAAATCCTTCTTCTCGAGAAGAAGGATTTAGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000140
VALIDATED
FECH MISSION shRNA shRNA Plasmid DNA
ferrochelatase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000140.1-736s1c1
Sequence:CCGGGCTTTGCAGATCATATTCTAACTCGAGTTAGAATATGATCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1262s1c1
Sequence:CCGGCAGGGAGACTAAATCCTTCTTCTCGAGAAGAAGGATTTAGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1047s1c1
Sequence:CCGGGACCATATTGAAACGCTGTATCTCGAGATACAGCGTTTCAATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1099s1c1
Sequence:CCGGCCAAGGAGTGTGGAGTTGAAACTCGAGTTTCAACTCCACACTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000140.3-824s21c1
Sequence:CCGGGCTTTGCAGATCATATTCTAACTCGAGTTAGAATATGATCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000140.3-1135s21c1
Sequence:CCGGGACCATATTGAAACGCTGTATCTCGAGATACAGCGTTTCAATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000140.3-670s21c1
Sequence:CCGGGCTATTGCTTTCACACAGTATCTCGAGATACTGTGTGAAAGCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000140.3-1350s21c1
Sequence:CCGGCAGGGAGACTAAATCCTTCTTCTCGAGAAGAAGGATTTAGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000140
VALIDATED
FECH MISSION shRNA Lentiviral Transduction Particles
ferrochelatase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000140.1-736s1c1
Sequence:CCGGGCTTTGCAGATCATATTCTAACTCGAGTTAGAATATGATCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1262s1c1
Sequence:CCGGCAGGGAGACTAAATCCTTCTTCTCGAGAAGAAGGATTTAGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1047s1c1
Sequence:CCGGGACCATATTGAAACGCTGTATCTCGAGATACAGCGTTTCAATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000140.1-1099s1c1
Sequence:CCGGCCAAGGAGTGTGGAGTTGAAACTCGAGTTTCAACTCCACACTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000140.3-824s21c1
Sequence:CCGGGCTTTGCAGATCATATTCTAACTCGAGTTAGAATATGATCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000140.3-1135s21c1
Sequence:CCGGGACCATATTGAAACGCTGTATCTCGAGATACAGCGTTTCAATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000140.3-670s21c1
Sequence:CCGGGCTATTGCTTTCACACAGTATCTCGAGATACTGTGTGAAAGCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000140.3-1350s21c1
Sequence:CCGGCAGGGAGACTAAATCCTTCTTCTCGAGAAGAAGGATTTAGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks