EMAIL THIS PAGE TO A FRIEND

FEM1B

fem-1 homolog b (C. elegans)

60 Gene Product Result for
Synonyms: F1A-ALPHA F1AA FEM1-beta
UniProtKB ID: Q9UK73, O43146
Gene ID:
Mouse(14155) feminization 1 homolog b (C. elegans)
Rat(315745) fem-1 homolog b (C. elegans)
Zebrafish(567119) fem-1 homolog b (C. elegans)
Horse(100052688) fem-1 homolog b (C. elegans)
cow(540252) fem-1 homolog b (C. elegans)
domestic cat(101093776) fem-1 homolog b (C. elegans)
chicken(415559) fem-1 homolog b (C. elegans)
dog(478352) fem-1 homolog b (C. elegans)
naked mole-rat(101707037) fem-1 homolog b (C. elegans)
domestic guinea pig(100733293) fem-1 homolog b (C. elegans)
sheep(101113243) fem-1 homolog b (C. elegans)
Domestic Rabbit(100344502) fem-1 homolog b (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS2279 Anti-F1Aα antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV53702 Anti-FEM1B (AB1) antibody produced in rabbit affinity isolated antibody canine, rat, rabbit, mouse, bovine, horse, human, guinea pig
western blot pricing
AV53703 Anti-FEM1B (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, canine, horse, rat, human, mouse, bovine
western blot pricing
SAB2108074 Anti-FEM1B antibody produced in rabbit affinity isolated antibody canine, rat, guinea pig, mouse, horse, human, bovine, rabbit
western blot pricing
SAB2900381 Anti-FEM1B antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rabbit, pig, human, bovine, dog, hamster, monkey, mouse, rat, horse
immunohistochemistry, western blot pricing
HPA041920 Anti-FEM1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA042192 Anti-FEM1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1403048 Monoclonal Anti-FEM1B antibody produced in mouse clone 4B12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015322 Rosetta Predictions human pricing
NM_001108157 Rosetta Predictions rat pricing
NM_010193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158036 predicted 1680
2 SASI_Hs01_00158037 predicted 1077
3 SASI_Hs01_00158038 predicted 1769
4 SASI_Hs01_00158039 predicted 2087
5 SASI_Hs01_00158042 predicted 1913
6 SASI_Hs01_00158043 predicted 1105
7 SASI_Hs01_00158045 predicted 1431
8 SASI_Hs02_00347597 predicted 1519
9 SASI_Hs02_00347598 predicted 1018
10 SASI_Hs02_00347599 predicted 2135
11 SASI_Hs01_00158040 predicted 1513
12 SASI_Hs01_00158041 predicted 1949
13 SASI_Hs01_00158044 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235914 predicted 1232
2 SASI_Rn02_00235915 predicted 678
3 SASI_Rn02_00235916 predicted 1853
4 SASI_Rn02_00235917 predicted 1301
5 SASI_Rn02_00235918 predicted 1610
6 SASI_Rn02_00235919 predicted 1574
7 SASI_Rn02_00235920 predicted 1062
8 SASI_Rn02_00235921 predicted 1846
9 SASI_Rn02_00235922 predicted 1560
10 SASI_Rn02_00235923 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317998 predicted 1732
2 SASI_Mm01_00102398 predicted 834
3 SASI_Mm02_00317999 predicted 1450
4 SASI_Mm01_00102399 predicted 775
5 SASI_Mm01_00102400 predicted 1698
6 SASI_Mm01_00102401 predicted 1321
7 SASI_Mm01_00102402 predicted 1488
8 SASI_Mm01_00102403 predicted 1154
9 SASI_Mm01_00102406 predicted 1656
10 SASI_Mm02_00318000 predicted 1007
11 SASI_Mm01_00102397 predicted 1350
12 SASI_Mm01_00102404 predicted 2114
13 SASI_Mm01_00102405 predicted 1888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015322
VALIDATED
FEM1B MISSION shRNA Bacterial Glycerol Stock
fem-1 homolog b (C. elegans)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-2229s1c1
Sequence:CCGGCCTTCATATTATCGTTCAGTACTCGAGTACTGAACGATAATATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-1459s1c1
Sequence:CCGGGCCATGTTAGAGAGGTTCCAACTCGAGTTGGAACCTCTCTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-1288s1c1
Sequence:CCGGCCATTGAAAGTAGCTGCCGAACTCGAGTTCGGCAGCTACTTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-2314s1c1
Sequence:CCGGGCTCACACTGACATGACGAATCTCGAGATTCGTCATGTCAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1086s21c1
Sequence:CCGGCCTAATGATTGCGGCATATAACTCGAGTTATATGCCGCAATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1450s21c1
Sequence:CCGGGCCATGTTAGAGAGGTTCCAACTCGAGTTGGAACCTCTCTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-801s21c1
Sequence:CCGGACGCTTGCTCTTAGAACATTACTCGAGTAATGTTCTAAGAGCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1667s21c1
Sequence:CCGGGAGCTGTTTATGCGGATAATACTCGAGTATTATCCGCATAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1428s21c1
Sequence:CCGGGACATACCACTATCTATATTTCTCGAGAAATATAGATAGTGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015322
VALIDATED
FEM1B MISSION shRNA shRNA Plasmid DNA
fem-1 homolog b (C. elegans)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-2229s1c1
Sequence:CCGGCCTTCATATTATCGTTCAGTACTCGAGTACTGAACGATAATATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-1459s1c1
Sequence:CCGGGCCATGTTAGAGAGGTTCCAACTCGAGTTGGAACCTCTCTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-1288s1c1
Sequence:CCGGCCATTGAAAGTAGCTGCCGAACTCGAGTTCGGCAGCTACTTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-2314s1c1
Sequence:CCGGGCTCACACTGACATGACGAATCTCGAGATTCGTCATGTCAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1086s21c1
Sequence:CCGGCCTAATGATTGCGGCATATAACTCGAGTTATATGCCGCAATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1450s21c1
Sequence:CCGGGCCATGTTAGAGAGGTTCCAACTCGAGTTGGAACCTCTCTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-801s21c1
Sequence:CCGGACGCTTGCTCTTAGAACATTACTCGAGTAATGTTCTAAGAGCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1667s21c1
Sequence:CCGGGAGCTGTTTATGCGGATAATACTCGAGTATTATCCGCATAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1428s21c1
Sequence:CCGGGACATACCACTATCTATATTTCTCGAGAAATATAGATAGTGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015322
VALIDATED
FEM1B MISSION shRNA Lentiviral Transduction Particles
fem-1 homolog b (C. elegans)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-2229s1c1
Sequence:CCGGCCTTCATATTATCGTTCAGTACTCGAGTACTGAACGATAATATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-1459s1c1
Sequence:CCGGGCCATGTTAGAGAGGTTCCAACTCGAGTTGGAACCTCTCTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-1288s1c1
Sequence:CCGGCCATTGAAAGTAGCTGCCGAACTCGAGTTCGGCAGCTACTTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015322.2-2314s1c1
Sequence:CCGGGCTCACACTGACATGACGAATCTCGAGATTCGTCATGTCAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1086s21c1
Sequence:CCGGCCTAATGATTGCGGCATATAACTCGAGTTATATGCCGCAATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1450s21c1
Sequence:CCGGGCCATGTTAGAGAGGTTCCAACTCGAGTTGGAACCTCTCTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-801s21c1
Sequence:CCGGACGCTTGCTCTTAGAACATTACTCGAGTAATGTTCTAAGAGCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1667s21c1
Sequence:CCGGGAGCTGTTTATGCGGATAATACTCGAGTATTATCCGCATAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015322.3-1428s21c1
Sequence:CCGGGACATACCACTATCTATATTTCTCGAGAAATATAGATAGTGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010193
FEM1B MISSION shRNA Bacterial Glycerol Stock
fem-1 homolog b (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010193.3-805s1c1
Sequence:CCGGGTCAGATACCTCTTAGAACAACTCGAGTTGTTCTAAGAGGTATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010193.3-2920s1c1
Sequence:CCGGGCACACTGTATTATGAAACATCTCGAGATGTTTCATAATACAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-1151s21c1
Sequence:CCGGATGAAGACATACCACTATTTACTCGAGTAAATAGTGGTATGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010193.4-814s1c1
Sequence:CCGGCCTAATGATCGCAGCATATAACTCGAGTTATATGCTGCGATCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-1659s21c1
Sequence:CCGGACTATGAGTGTAACCTCTATACTCGAGTATAGAGGTTACACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-814s21c1
Sequence:CCGGCCTAATGATCGCAGCATATAACTCGAGTTATATGCTGCGATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010193.4-3881s21c1
Sequence:CCGGGGTGTTGGAATGCCCTAATTTCTCGAGAAATTAGGGCATTCCAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-418s21c1
Sequence:CCGGTAACCGGTCAGAGAGCGATATCTCGAGATATCGCTCTCTGACCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010193
FEM1B MISSION shRNA shRNA Plasmid DNA
fem-1 homolog b (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010193.3-805s1c1
Sequence:CCGGGTCAGATACCTCTTAGAACAACTCGAGTTGTTCTAAGAGGTATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010193.3-2920s1c1
Sequence:CCGGGCACACTGTATTATGAAACATCTCGAGATGTTTCATAATACAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-1151s21c1
Sequence:CCGGATGAAGACATACCACTATTTACTCGAGTAAATAGTGGTATGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010193.4-814s1c1
Sequence:CCGGCCTAATGATCGCAGCATATAACTCGAGTTATATGCTGCGATCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-1659s21c1
Sequence:CCGGACTATGAGTGTAACCTCTATACTCGAGTATAGAGGTTACACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-814s21c1
Sequence:CCGGCCTAATGATCGCAGCATATAACTCGAGTTATATGCTGCGATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010193.4-3881s21c1
Sequence:CCGGGGTGTTGGAATGCCCTAATTTCTCGAGAAATTAGGGCATTCCAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-418s21c1
Sequence:CCGGTAACCGGTCAGAGAGCGATATCTCGAGATATCGCTCTCTGACCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010193
FEM1B MISSION shRNA Lentiviral Transduction Particles
fem-1 homolog b (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010193.3-805s1c1
Sequence:CCGGGTCAGATACCTCTTAGAACAACTCGAGTTGTTCTAAGAGGTATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010193.3-2920s1c1
Sequence:CCGGGCACACTGTATTATGAAACATCTCGAGATGTTTCATAATACAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-1151s21c1
Sequence:CCGGATGAAGACATACCACTATTTACTCGAGTAAATAGTGGTATGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010193.4-814s1c1
Sequence:CCGGCCTAATGATCGCAGCATATAACTCGAGTTATATGCTGCGATCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-1659s21c1
Sequence:CCGGACTATGAGTGTAACCTCTATACTCGAGTATAGAGGTTACACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-814s21c1
Sequence:CCGGCCTAATGATCGCAGCATATAACTCGAGTTATATGCTGCGATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010193.4-3881s21c1
Sequence:CCGGGGTGTTGGAATGCCCTAATTTCTCGAGAAATTAGGGCATTCCAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010193.4-418s21c1
Sequence:CCGGTAACCGGTCAGAGAGCGATATCTCGAGATATCGCTCTCTGACCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks