EMAIL THIS PAGE TO A FRIEND

FEM1C

fem-1 homolog c (C. elegans)

Synonyms: EUROIMAGE686608 EUROIMAGE783647 FEM1A
UniProtKB ID: Q96JP0, B2RE47, Q8N3V8, Q9H704, Q9NPL6, Q9NPL9
Gene ID:
Mouse(240263) fem-1 homolog c (C.elegans)
Rat(302288) fem-1 homolog c (C. elegans)
sheep(101106330) fem-1 homolog c (C. elegans)
Domestic Rabbit(100346437) fem-1 homolog c (C. elegans)
domestic guinea pig(100736128) fem-1 homolog c (C. elegans)
naked mole-rat(101722929) fem-1 homolog c (C. elegans)
Zebrafish(378965) fem-1 homolog c (C.elegans)
domestic cat(101090077) fem-1 homolog c (C. elegans)
dog(481437) fem-1 homolog c (C. elegans)
chicken(431262) fem-1 homolog c (C. elegans)
159 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020177 Rosetta Predictions human pricing
NM_001106932 Rosetta Predictions rat pricing
NM_173423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068899 predicted 1431
2 SASI_Hs01_00068900 predicted 923
3 SASI_Hs01_00068901 predicted 617
4 SASI_Hs01_00068903 predicted 1008
5 SASI_Hs01_00068905 predicted 563
6 SASI_Hs01_00068906 predicted 1893
7 SASI_Hs01_00068907 predicted 2178
8 SASI_Hs01_00068908 predicted 1513
9 SASI_Hs02_00353092 predicted 2484
10 SASI_Hs02_00353093 predicted 1115
11 SASI_Hs01_00068902 predicted 1667
12 SASI_Hs01_00068904 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223826 predicted 1869
2 SASI_Rn02_00223827 predicted 1540
3 SASI_Rn02_00223828 predicted 1803
4 SASI_Rn02_00223829 predicted 1402
5 SASI_Rn02_00223830 predicted 909
6 SASI_Rn02_00223831 predicted 978
7 SASI_Rn02_00223832 predicted 1931
8 SASI_Rn02_00223833 predicted 1074
9 SASI_Rn02_00223834 predicted 623
10 SASI_Rn02_00223835 predicted 2161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161970 predicted 1866
2 SASI_Mm01_00161971 predicted 881
3 SASI_Mm01_00161972 predicted 1499
4 SASI_Mm01_00161973 predicted 621
5 SASI_Mm02_00345303 predicted 985
6 SASI_Mm01_00161974 predicted 1489
7 SASI_Mm01_00161975 predicted 912
8 SASI_Mm01_00161977 predicted 1155
9 SASI_Mm01_00161978 predicted 1138
10 SASI_Mm01_00161979 predicted 2156
11 SASI_Mm01_00161976 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173423
FEM1C MISSION shRNA Bacterial Glycerol Stock
fem-1 homolog c (C. elegans)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1491s21c1
Sequence:CCGGTGAGAATGCAAGCGCTGTTAACTCGAGTTAACAGCGCTTGCATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-2311s21c1
Sequence:CCGGTCGTGTCATCGTGAATCATAGCTCGAGCTATGATTCACGATGACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-2163s21c1
Sequence:CCGGACATCATGAATCTCCTTATTACTCGAGTAATAAGGAGATTCATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-943s21c1
Sequence:CCGGTGTAGAACACAAAGCCGATTTCTCGAGAAATCGGCTTTGTGTTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1366s21c1
Sequence:CCGGGTACAGTGATAGGACTAATATCTCGAGATATTAGTCCTATCACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173423.4-2400s21c1
Sequence:CCGGATTGTGCTTCAGCACCGTTAACTCGAGTTAACGGTGCTGAAGCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1453s21c1
Sequence:CCGGAGAAGAGTTAGAAGGTCTTATCTCGAGATAAGACCTTCTAACTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173423.1-2496s1c1
Sequence:CCGGCCATTGGCTAAAGCATTGTAACTCGAGTTACAATGCTTTAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-2276s1c1
Sequence:CCGGGCCCATAAATCATACCACATTCTCGAGAATGTGGTATGATTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-1643s1c1
Sequence:CCGGGCAGAGCAATTTGGACCCTTTCTCGAGAAAGGGTCCAAATTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-613s1c1
Sequence:CCGGGCAAATCGAAAGCGGAGGTTTCTCGAGAAACCTCCGCTTTCGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-1605s1c1
Sequence:CCGGCGATGCATCAACCTATGGAAACTCGAGTTTCCATAGGTTGATGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173423
FEM1C MISSION shRNA shRNA Plasmid DNA
fem-1 homolog c (C. elegans)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1491s21c1
Sequence:CCGGTGAGAATGCAAGCGCTGTTAACTCGAGTTAACAGCGCTTGCATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-2311s21c1
Sequence:CCGGTCGTGTCATCGTGAATCATAGCTCGAGCTATGATTCACGATGACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-2163s21c1
Sequence:CCGGACATCATGAATCTCCTTATTACTCGAGTAATAAGGAGATTCATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-943s21c1
Sequence:CCGGTGTAGAACACAAAGCCGATTTCTCGAGAAATCGGCTTTGTGTTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1366s21c1
Sequence:CCGGGTACAGTGATAGGACTAATATCTCGAGATATTAGTCCTATCACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173423.4-2400s21c1
Sequence:CCGGATTGTGCTTCAGCACCGTTAACTCGAGTTAACGGTGCTGAAGCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1453s21c1
Sequence:CCGGAGAAGAGTTAGAAGGTCTTATCTCGAGATAAGACCTTCTAACTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173423.1-2496s1c1
Sequence:CCGGCCATTGGCTAAAGCATTGTAACTCGAGTTACAATGCTTTAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-2276s1c1
Sequence:CCGGGCCCATAAATCATACCACATTCTCGAGAATGTGGTATGATTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-1643s1c1
Sequence:CCGGGCAGAGCAATTTGGACCCTTTCTCGAGAAAGGGTCCAAATTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-613s1c1
Sequence:CCGGGCAAATCGAAAGCGGAGGTTTCTCGAGAAACCTCCGCTTTCGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-1605s1c1
Sequence:CCGGCGATGCATCAACCTATGGAAACTCGAGTTTCCATAGGTTGATGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173423
FEM1C MISSION shRNA Lentiviral Transduction Particles
fem-1 homolog c (C. elegans)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1491s21c1
Sequence:CCGGTGAGAATGCAAGCGCTGTTAACTCGAGTTAACAGCGCTTGCATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-2311s21c1
Sequence:CCGGTCGTGTCATCGTGAATCATAGCTCGAGCTATGATTCACGATGACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-2163s21c1
Sequence:CCGGACATCATGAATCTCCTTATTACTCGAGTAATAAGGAGATTCATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-943s21c1
Sequence:CCGGTGTAGAACACAAAGCCGATTTCTCGAGAAATCGGCTTTGTGTTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1366s21c1
Sequence:CCGGGTACAGTGATAGGACTAATATCTCGAGATATTAGTCCTATCACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173423.4-2400s21c1
Sequence:CCGGATTGTGCTTCAGCACCGTTAACTCGAGTTAACGGTGCTGAAGCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173423.4-1453s21c1
Sequence:CCGGAGAAGAGTTAGAAGGTCTTATCTCGAGATAAGACCTTCTAACTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173423.1-2496s1c1
Sequence:CCGGCCATTGGCTAAAGCATTGTAACTCGAGTTACAATGCTTTAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-2276s1c1
Sequence:CCGGGCCCATAAATCATACCACATTCTCGAGAATGTGGTATGATTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-1643s1c1
Sequence:CCGGGCAGAGCAATTTGGACCCTTTCTCGAGAAAGGGTCCAAATTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-613s1c1
Sequence:CCGGGCAAATCGAAAGCGGAGGTTTCTCGAGAAACCTCCGCTTTCGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173423.1-1605s1c1
Sequence:CCGGCGATGCATCAACCTATGGAAACTCGAGTTTCCATAGGTTGATGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020177
VALIDATED
FEM1C MISSION shRNA Bacterial Glycerol Stock
fem-1 homolog c (C. elegans)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2831s21c1
Sequence:CCGGATTGTTTGTCCTAACCATTTCCTCGAGGAAATGGTTAGGACAAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020177.2-1789s21c1
Sequence:CCGGTGATCTTATGGGCATACTTTGCTCGAGCAAAGTATGCCCATAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020177.2-1565s21c1
Sequence:CCGGCCTGATACCTCTTACTATATTCTCGAGAATATAGTAAGAGGTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2552s21c1
Sequence:CCGGAGCATCAAATTTACAACATTGCTCGAGCAATGTTGTAAATTTGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2435s21c1
Sequence:CCGGGCACTGTTAAAGCACGAATTGCTCGAGCAATTCGTGCTTTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-2183s1c1
Sequence:CCGGCCAGACATCATGAATCTCCTTCTCGAGAAGGAGATTCATGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020177.2-2495s1c1
Sequence:CCGGCCAGCATTCATTTAGCTTGATCTCGAGATCAAGCTAAATGAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-1115s1c1
Sequence:CCGGGCATTGCATGATTGTGCAGAACTCGAGTTCTGCACAATCATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1765s1c1
Sequence:CCGGGCTGGGTACTACTGTTACATTCTCGAGAATGTAACAGTAGTACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-1278s1c1
Sequence:CCGGCCAGCAAGACAGAACGTATTACTCGAGTAATACGTTCTGTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-2333s1c1
Sequence:CCGGGCTCGTGTCATAGTGAATCATCTCGAGATGATTCACTATGACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1835s1c1
Sequence:CCGGGCTATCAAACAAACTCAGTGTCTCGAGACACTGAGTTTGTTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1116s1c1
Sequence:CCGGCATTGCATGATTGTGCAGAATCTCGAGATTCTGCACAATCATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-621s1c1
Sequence:CCGGCCAAATTGTTGGCAAGCAAATCTCGAGATTTGCTTGCCAACAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020177.2-4431s1c1
Sequence:CCGGGCCTCTAACTTTGTGGTATAACTCGAGTTATACCACAAAGTTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020177
VALIDATED
FEM1C MISSION shRNA shRNA Plasmid DNA
fem-1 homolog c (C. elegans)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2831s21c1
Sequence:CCGGATTGTTTGTCCTAACCATTTCCTCGAGGAAATGGTTAGGACAAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020177.2-1789s21c1
Sequence:CCGGTGATCTTATGGGCATACTTTGCTCGAGCAAAGTATGCCCATAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020177.2-1565s21c1
Sequence:CCGGCCTGATACCTCTTACTATATTCTCGAGAATATAGTAAGAGGTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2552s21c1
Sequence:CCGGAGCATCAAATTTACAACATTGCTCGAGCAATGTTGTAAATTTGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2435s21c1
Sequence:CCGGGCACTGTTAAAGCACGAATTGCTCGAGCAATTCGTGCTTTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-2183s1c1
Sequence:CCGGCCAGACATCATGAATCTCCTTCTCGAGAAGGAGATTCATGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020177.2-2495s1c1
Sequence:CCGGCCAGCATTCATTTAGCTTGATCTCGAGATCAAGCTAAATGAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-1115s1c1
Sequence:CCGGGCATTGCATGATTGTGCAGAACTCGAGTTCTGCACAATCATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1765s1c1
Sequence:CCGGGCTGGGTACTACTGTTACATTCTCGAGAATGTAACAGTAGTACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-1278s1c1
Sequence:CCGGCCAGCAAGACAGAACGTATTACTCGAGTAATACGTTCTGTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-2333s1c1
Sequence:CCGGGCTCGTGTCATAGTGAATCATCTCGAGATGATTCACTATGACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1835s1c1
Sequence:CCGGGCTATCAAACAAACTCAGTGTCTCGAGACACTGAGTTTGTTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1116s1c1
Sequence:CCGGCATTGCATGATTGTGCAGAATCTCGAGATTCTGCACAATCATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-621s1c1
Sequence:CCGGCCAAATTGTTGGCAAGCAAATCTCGAGATTTGCTTGCCAACAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020177.2-4431s1c1
Sequence:CCGGGCCTCTAACTTTGTGGTATAACTCGAGTTATACCACAAAGTTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020177
VALIDATED
FEM1C MISSION shRNA Lentiviral Transduction Particles
fem-1 homolog c (C. elegans)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2831s21c1
Sequence:CCGGATTGTTTGTCCTAACCATTTCCTCGAGGAAATGGTTAGGACAAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020177.2-1789s21c1
Sequence:CCGGTGATCTTATGGGCATACTTTGCTCGAGCAAAGTATGCCCATAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020177.2-1565s21c1
Sequence:CCGGCCTGATACCTCTTACTATATTCTCGAGAATATAGTAAGAGGTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2552s21c1
Sequence:CCGGAGCATCAAATTTACAACATTGCTCGAGCAATGTTGTAAATTTGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020177.2-2435s21c1
Sequence:CCGGGCACTGTTAAAGCACGAATTGCTCGAGCAATTCGTGCTTTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-2183s1c1
Sequence:CCGGCCAGACATCATGAATCTCCTTCTCGAGAAGGAGATTCATGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020177.2-2495s1c1
Sequence:CCGGCCAGCATTCATTTAGCTTGATCTCGAGATCAAGCTAAATGAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-1115s1c1
Sequence:CCGGGCATTGCATGATTGTGCAGAACTCGAGTTCTGCACAATCATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1765s1c1
Sequence:CCGGGCTGGGTACTACTGTTACATTCTCGAGAATGTAACAGTAGTACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-1278s1c1
Sequence:CCGGCCAGCAAGACAGAACGTATTACTCGAGTAATACGTTCTGTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-2333s1c1
Sequence:CCGGGCTCGTGTCATAGTGAATCATCTCGAGATGATTCACTATGACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1835s1c1
Sequence:CCGGGCTATCAAACAAACTCAGTGTCTCGAGACACTGAGTTTGTTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020177.2-1116s1c1
Sequence:CCGGCATTGCATGATTGTGCAGAATCTCGAGATTCTGCACAATCATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020177.2-621s1c1
Sequence:CCGGCCAAATTGTTGGCAAGCAAATCTCGAGATTTGCTTGCCAACAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020177.2-4431s1c1
Sequence:CCGGGCCTCTAACTTTGTGGTATAACTCGAGTTATACCACAAAGTTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks