EMAIL THIS PAGE TO A FRIEND

FEN1

flap structure-specific endonuclease 1

66 Gene Product Result for
Synonyms: FEN-1 MF1 RAD2
UniProtKB ID: P39748
Gene ID:
Human(2237) Summary: The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
Mouse(14156) flap structure specific endonuclease 1
Rat(84490) flap structure-specific endonuclease 1
Zebrafish(386707) flap structure-specific endonuclease 1
fruit fly(36887) Flap endonuclease 1
cow(616242) flap structure-specific endonuclease 1
Horse(100059838) flap structure-specific endonuclease 1
domestic cat(101083708) flap structure-specific endonuclease 1
dog(476063) flap structure-specific endonuclease 1
chicken(769677) flap structure-specific endonuclease 1
sheep(100307042) flap structure-specific endonuclease 1
Domestic Rabbit(100352966) flap structure-specific endonuclease 1
naked mole-rat(101698770) flap structure-specific endonuclease 1
domestic guinea pig(100723622) flap structure-specific endonuclease 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F1305 Anti-FEN-1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, western blot pricing
F1430 Anti-FEN-1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, western blot pricing
HPA006748 Anti-FEN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AV46097 Anti-FEN1 antibody produced in rabbit IgG fraction of antiserum , mouse, zebrafish, canine, guinea pig, horse, rabbit, human, bovine, rat, sheep
western blot pricing
SAB4500881 Anti-FEN1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0002237M1 Monoclonal Anti-FEN1 antibody produced in mouse clone 1E2, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing
SAB2702148 Monoclonal Anti-FEN1 antibody produced in mouse human, mouse
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004111 Rosetta Predictions human pricing
NM_053430 Rosetta Predictions rat pricing
NM_007999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336939 predicted 1562
2 SASI_Hs02_00336940 predicted 1286
3 SASI_Hs02_00336941 predicted 1545
4 SASI_Hs02_00336942 predicted 1341
5 SASI_Hs02_00336943 predicted 1387
6 SASI_Hs02_00336944 predicted 469
7 SASI_Hs02_00336945 predicted 1162
8 SASI_Hs02_00336946 predicted 600
9 SASI_Hs02_00336947 predicted 933
10 SASI_Hs01_00209193 predicted 777
11 SASI_Hs01_00209194 predicted 769
12 SASI_Hs01_00209195 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088038 predicted 257
2 SASI_Rn01_00088039 predicted 1048
3 SASI_Rn01_00088040 predicted 1157
4 SASI_Rn01_00088041 predicted 491
5 SASI_Rn01_00088042 predicted 1155
6 SASI_Rn01_00088043 predicted 484
7 SASI_Rn01_00088044 predicted 1050
8 SASI_Rn02_00265983 predicted 914
9 SASI_Rn01_00088045 predicted 817
10 SASI_Rn02_00265984 predicted 1601
11 SASI_Rn01_00088046 predicted 1282
12 SASI_Rn01_00088047 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312926 predicted 867
2 SASI_Mm01_00029071 predicted 275
3 SASI_Mm01_00029072 predicted 1628
4 SASI_Mm01_00029073 predicted 1629
5 SASI_Mm01_00029074 predicted 1634
6 SASI_Mm02_00312927 predicted 1549
7 SASI_Mm01_00029075 predicted 1175
8 SASI_Mm01_00029076 predicted 937
9 SASI_Mm01_00029077 predicted 478
10 SASI_Mm01_00029078 predicted 1290
11 SASI_Mm01_00029070 predicted 1683
12 SASI_Mm01_00029079 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004111
VALIDATED
FEN1 MISSION shRNA Bacterial Glycerol Stock
flap structure-specific endonuclease 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004111.4-615s1c1
Sequence:CCGGCGTGTATGTCTTTGATGGCAACTCGAGTTGCCATCAAAGACATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-1064s1c1
Sequence:CCGGGCAGTGACTACTGTGAGAGTACTCGAGTACTCTCACAGTAGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-472s1c1
Sequence:CCGGGATGCCTCTATGAGCATTTATCTCGAGATAAATGCTCATAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-1272s1c1
Sequence:CCGGGCCAAATGAAGAAGAGCTGATCTCGAGATCAGCTCTTCTTCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-441s1c1
Sequence:CCGGCAAGAGCTACTTTGGCCGTAACTCGAGTTACGGCCAAAGTAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-808s21c1
Sequence:CCGGAGCCTCATGGGCATCCCTTATCTCGAGATAAGGGATGCCCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-472s21c1
Sequence:CCGGGATGCCTCTATGAGCATTTATCTCGAGATAAATGCTCATAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004111.4-1064s21c1
Sequence:CCGGGCAGTGACTACTGTGAGAGTACTCGAGTACTCTCACAGTAGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-1272s21c1
Sequence:CCGGGCCAAATGAAGAAGAGCTGATCTCGAGATCAGCTCTTCTTCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-1554s21c1
Sequence:CCGGTTGCCGTCTTGTACCCTTAAGCTCGAGCTTAAGGGTACAAGACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004111.4-615s21c1
Sequence:CCGGCGTGTATGTCTTTGATGGCAACTCGAGTTGCCATCAAAGACATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004111
VALIDATED
FEN1 MISSION shRNA shRNA Plasmid DNA
flap structure-specific endonuclease 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004111.4-615s1c1
Sequence:CCGGCGTGTATGTCTTTGATGGCAACTCGAGTTGCCATCAAAGACATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-1064s1c1
Sequence:CCGGGCAGTGACTACTGTGAGAGTACTCGAGTACTCTCACAGTAGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-472s1c1
Sequence:CCGGGATGCCTCTATGAGCATTTATCTCGAGATAAATGCTCATAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-1272s1c1
Sequence:CCGGGCCAAATGAAGAAGAGCTGATCTCGAGATCAGCTCTTCTTCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-441s1c1
Sequence:CCGGCAAGAGCTACTTTGGCCGTAACTCGAGTTACGGCCAAAGTAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-808s21c1
Sequence:CCGGAGCCTCATGGGCATCCCTTATCTCGAGATAAGGGATGCCCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-472s21c1
Sequence:CCGGGATGCCTCTATGAGCATTTATCTCGAGATAAATGCTCATAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004111.4-1064s21c1
Sequence:CCGGGCAGTGACTACTGTGAGAGTACTCGAGTACTCTCACAGTAGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-1272s21c1
Sequence:CCGGGCCAAATGAAGAAGAGCTGATCTCGAGATCAGCTCTTCTTCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-1554s21c1
Sequence:CCGGTTGCCGTCTTGTACCCTTAAGCTCGAGCTTAAGGGTACAAGACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004111.4-615s21c1
Sequence:CCGGCGTGTATGTCTTTGATGGCAACTCGAGTTGCCATCAAAGACATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004111
VALIDATED
FEN1 MISSION shRNA Lentiviral Transduction Particles
flap structure-specific endonuclease 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004111.4-615s1c1
Sequence:CCGGCGTGTATGTCTTTGATGGCAACTCGAGTTGCCATCAAAGACATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-1064s1c1
Sequence:CCGGGCAGTGACTACTGTGAGAGTACTCGAGTACTCTCACAGTAGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-472s1c1
Sequence:CCGGGATGCCTCTATGAGCATTTATCTCGAGATAAATGCTCATAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-1272s1c1
Sequence:CCGGGCCAAATGAAGAAGAGCTGATCTCGAGATCAGCTCTTCTTCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004111.4-441s1c1
Sequence:CCGGCAAGAGCTACTTTGGCCGTAACTCGAGTTACGGCCAAAGTAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-808s21c1
Sequence:CCGGAGCCTCATGGGCATCCCTTATCTCGAGATAAGGGATGCCCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-472s21c1
Sequence:CCGGGATGCCTCTATGAGCATTTATCTCGAGATAAATGCTCATAGAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004111.4-1064s21c1
Sequence:CCGGGCAGTGACTACTGTGAGAGTACTCGAGTACTCTCACAGTAGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-1272s21c1
Sequence:CCGGGCCAAATGAAGAAGAGCTGATCTCGAGATCAGCTCTTCTTCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004111.4-1554s21c1
Sequence:CCGGTTGCCGTCTTGTACCCTTAAGCTCGAGCTTAAGGGTACAAGACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004111.4-615s21c1
Sequence:CCGGCGTGTATGTCTTTGATGGCAACTCGAGTTGCCATCAAAGACATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007999
VALIDATED
FEN1 MISSION shRNA Bacterial Glycerol Stock
flap structure-specific endonuclease 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007999.2-449s1c1
Sequence:CCGGGTGTACGTCTTTGATGGCAAACTCGAGTTTGCCATCAAAGACGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-611s1c1
Sequence:CCGGCAACACAATGATGAGTGCAAACTCGAGTTTGCACTCATCATTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007999.2-265s1c1
Sequence:CCGGGAATGACATCAAGAGCTACTTCTCGAGAAGTAGCTCTTGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-1291s1c1
Sequence:CCGGGCCTGCTAAGAAGAAAGCAAACTCGAGTTTGCTTTCTTCTTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-768s1c1
Sequence:CCGGCCGTGCTAATGCGACACTTAACTCGAGTTAAGTGTCGCATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-335s21c1
Sequence:CCGGGAATGACATCAAGAGCTACTTCTCGAGAAGTAGCTCTTGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007999.3-1643s21c1
Sequence:CCGGTAATGGACACTGTAGTCATTGCTCGAGCAATGACTACAGTGTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-519s21c1
Sequence:CCGGGTGTACGTCTTTGATGGCAAACTCGAGTTTGCCATCAAAGACGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-1184s21c1
Sequence:CCGGAGAAGAGTTGGTCAAATTTATCTCGAGATAAATTTGACCAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007999
VALIDATED
FEN1 MISSION shRNA shRNA Plasmid DNA
flap structure-specific endonuclease 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007999.2-449s1c1
Sequence:CCGGGTGTACGTCTTTGATGGCAAACTCGAGTTTGCCATCAAAGACGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-611s1c1
Sequence:CCGGCAACACAATGATGAGTGCAAACTCGAGTTTGCACTCATCATTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007999.2-265s1c1
Sequence:CCGGGAATGACATCAAGAGCTACTTCTCGAGAAGTAGCTCTTGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-1291s1c1
Sequence:CCGGGCCTGCTAAGAAGAAAGCAAACTCGAGTTTGCTTTCTTCTTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-768s1c1
Sequence:CCGGCCGTGCTAATGCGACACTTAACTCGAGTTAAGTGTCGCATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-335s21c1
Sequence:CCGGGAATGACATCAAGAGCTACTTCTCGAGAAGTAGCTCTTGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007999.3-1643s21c1
Sequence:CCGGTAATGGACACTGTAGTCATTGCTCGAGCAATGACTACAGTGTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-519s21c1
Sequence:CCGGGTGTACGTCTTTGATGGCAAACTCGAGTTTGCCATCAAAGACGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-1184s21c1
Sequence:CCGGAGAAGAGTTGGTCAAATTTATCTCGAGATAAATTTGACCAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007999
VALIDATED
FEN1 MISSION shRNA Lentiviral Transduction Particles
flap structure-specific endonuclease 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007999.2-449s1c1
Sequence:CCGGGTGTACGTCTTTGATGGCAAACTCGAGTTTGCCATCAAAGACGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-611s1c1
Sequence:CCGGCAACACAATGATGAGTGCAAACTCGAGTTTGCACTCATCATTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007999.2-265s1c1
Sequence:CCGGGAATGACATCAAGAGCTACTTCTCGAGAAGTAGCTCTTGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-1291s1c1
Sequence:CCGGGCCTGCTAAGAAGAAAGCAAACTCGAGTTTGCTTTCTTCTTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007999.2-768s1c1
Sequence:CCGGCCGTGCTAATGCGACACTTAACTCGAGTTAAGTGTCGCATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-335s21c1
Sequence:CCGGGAATGACATCAAGAGCTACTTCTCGAGAAGTAGCTCTTGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007999.3-1643s21c1
Sequence:CCGGTAATGGACACTGTAGTCATTGCTCGAGCAATGACTACAGTGTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-519s21c1
Sequence:CCGGGTGTACGTCTTTGATGGCAAACTCGAGTTTGCCATCAAAGACGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007999.3-1184s21c1
Sequence:CCGGAGAAGAGTTGGTCAAATTTATCTCGAGATAAATTTGACCAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks