EMAIL THIS PAGE TO A FRIEND

FER1L4

fer-1-like 4 (C. elegans), pseudogene

48 Gene Product Result for
Synonyms: C20orf124 bA563A22B.1 dJ309K20.1
UniProtKB ID: A9Z1Z3, Q9GZQ9, Q9H646, Q9H8L7
Gene ID:
Mouse(74562) fer-1-like 4 (C. elegans)
Rat(296307) fer-1-like 4 (C. elegans)
chicken(419135) fer-1-like 4 (C. elegans) pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_110396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125671 MISSION® esiRNA esiRNA human FER1L4 (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001106534 Rosetta Predictions rat pricing
XM_001481280 Rosetta Predictions mouse pricing
XM_001481335 Rosetta Predictions mouse pricing
XM_906662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219898 predicted 4343
2 SASI_Rn02_00219899 predicted 2571
3 SASI_Rn02_00219900 predicted 4974
4 SASI_Rn02_00219901 predicted 3721
5 SASI_Rn02_00219902 predicted 1566
6 SASI_Rn02_00219903 predicted 2376
7 SASI_Rn02_00219904 predicted 4336
8 SASI_Rn02_00219905 predicted 2553
9 SASI_Rn02_00219906 predicted 3600
10 SASI_Rn02_00219907 predicted 4951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423364 predicted 4776
2 SASI_Mm02_00423365 predicted 2775
3 SASI_Mm02_00423366 predicted 202
4 SASI_Mm02_00423367 predicted 4696
5 SASI_Mm02_00423368 predicted 1551
6 SASI_Mm02_00423369 predicted 995
7 SASI_Mm02_00423370 predicted 4043
8 SASI_Mm02_00423371 predicted 1385
9 SASI_Mm02_00423372 predicted 2182
10 SASI_Mm02_00423373 predicted 4152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423798 predicted 4778
2 SASI_Mm02_00423799 predicted 203
3 SASI_Mm02_00423800 predicted 4693
4 SASI_Mm02_00423801 predicted 1549
5 SASI_Mm02_00423802 predicted 987
6 SASI_Mm02_00423803 predicted 4044
7 SASI_Mm02_00423804 predicted 4061
8 SASI_Mm02_00423805 predicted 1391
9 SASI_Mm02_00423806 predicted 2189
10 SASI_Mm02_00423807 predicted 4149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204386 predicted 4908
2 SASI_Mm01_00204387 predicted 216
3 SASI_Mm01_00204388 predicted 1425
4 SASI_Mm01_00204389 predicted 865
5 SASI_Mm01_00204390 predicted 801
6 SASI_Mm01_00204391 predicted 4196
7 SASI_Mm01_00204392 predicted 1258
8 SASI_Mm01_00204393 predicted 2057
9 SASI_Mm01_00204394 predicted 5226
10 SASI_Mm01_00204395 predicted 4298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110396
FER1L4 MISSION shRNA Bacterial Glycerol Stock
fer-1-like 4 (C. elegans), pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-1546s1c1
Sequence:CCGGCGTGTACATCTGTTTGAGATACTCGAGTATCTCAAACAGATGTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-3781s1c1
Sequence:CCGGGCGGAGTTTGAACTGCTAACTCTCGAGAGTTAGCAGTTCAAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2728s1c1
Sequence:CCGGGCCTCCCAGTATGATGTGAATCTCGAGATTCACATCATACTGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2418s1c1
Sequence:CCGGGCTTCTAGTCAGAGTGTATATCTCGAGATATACACTCTGACTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2861s1c1
Sequence:CCGGGCAGAGTCTTTCTGACACCATCTCGAGATGGTGTCAGAAAGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110396
FER1L4 MISSION shRNA shRNA Plasmid DNA
fer-1-like 4 (C. elegans), pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-1546s1c1
Sequence:CCGGCGTGTACATCTGTTTGAGATACTCGAGTATCTCAAACAGATGTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-3781s1c1
Sequence:CCGGGCGGAGTTTGAACTGCTAACTCTCGAGAGTTAGCAGTTCAAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2728s1c1
Sequence:CCGGGCCTCCCAGTATGATGTGAATCTCGAGATTCACATCATACTGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2418s1c1
Sequence:CCGGGCTTCTAGTCAGAGTGTATATCTCGAGATATACACTCTGACTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2861s1c1
Sequence:CCGGGCAGAGTCTTTCTGACACCATCTCGAGATGGTGTCAGAAAGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110396
FER1L4 MISSION shRNA Lentiviral Transduction Particles
fer-1-like 4 (C. elegans), pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-1546s1c1
Sequence:CCGGCGTGTACATCTGTTTGAGATACTCGAGTATCTCAAACAGATGTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-3781s1c1
Sequence:CCGGGCGGAGTTTGAACTGCTAACTCTCGAGAGTTAGCAGTTCAAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2728s1c1
Sequence:CCGGGCCTCCCAGTATGATGTGAATCTCGAGATTCACATCATACTGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2418s1c1
Sequence:CCGGGCTTCTAGTCAGAGTGTATATCTCGAGATATACACTCTGACTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110396.3-2861s1c1
Sequence:CCGGGCAGAGTCTTTCTGACACCATCTCGAGATGGTGTCAGAAAGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks