EMAIL THIS PAGE TO A FRIEND

FER1L5

fer-1-like 5 (C. elegans)

44 Gene Product Result for
UniProtKB ID: A0AVI2, Q17RH2, Q6ZU24
Gene ID:
Mouse(100534273) fer-1-like 5 (C. elegans)
Rat(679806) fer-1-like 5 (C. elegans)
sheep(101114435) fer-1-like 5 (C. elegans)
domestic guinea pig(100714583) fer-1-like 5 (C. elegans)
naked mole-rat(101709118) fer-1-like 5 (C. elegans)
chicken(429452) fer-1-like 5 (C. elegans)
dog(481347) fer-1-like 5 (C. elegans)
Horse(100062182) fer-1-like 5 (C. elegans)
cow(526655) fer-1-like 5 (C. elegans)
domestic cat(101097802) fer-1-like 5 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077400 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136501 MISSION® esiRNA esiRNA human FER1L5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077400 Rosetta Predictions human pricing
NM_001113382 Rosetta Predictions human pricing
XM_031009 Rosetta Predictions human pricing
XM_001054536 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312474 predicted 973
2 SASI_Hs02_00312475 predicted 360
3 SASI_Hs02_00312476 predicted 2219
4 SASI_Hs02_00312477 predicted 2221
5 SASI_Hs02_00312478 predicted 906
6 SASI_Hs02_00312479 predicted 2272
7 SASI_Hs02_00312480 predicted 834
8 SASI_Hs02_00312481 predicted 972
9 SASI_Hs02_00312482 predicted 2201
10 SASI_Hs02_00312483 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325781 predicted 4739
2 SASI_Hs02_00325782 predicted 4129
3 SASI_Hs02_00325783 predicted 6022
4 SASI_Hs02_00325784 predicted 6020
5 SASI_Hs02_00325785 predicted 4678
6 SASI_Hs02_00325786 predicted 6071
7 SASI_Hs02_00325787 predicted 4600
8 SASI_Hs02_00325788 predicted 4745
9 SASI_Hs02_00325789 predicted 5996
10 SASI_Hs02_00325790 predicted 4357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_031009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274621 predicted 4652
2 SASI_Hs01_00274622 predicted 4155
3 SASI_Hs01_00274623 predicted 3552
4 SASI_Hs01_00274624 predicted 4645
5 SASI_Hs01_00274625 predicted 5418
6 SASI_Hs01_00274626 predicted 5409
7 SASI_Hs01_00274627 predicted 4098
8 SASI_Hs01_00274628 predicted 5506
9 SASI_Hs01_00274629 predicted 4232
10 SASI_Hs01_00274630 predicted 5469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276189 predicted 5509
2 SASI_Rn02_00276190 predicted 5282
3 SASI_Rn02_00276191 predicted 5460
4 SASI_Rn02_00276192 predicted 370
5 SASI_Rn02_00276193 predicted 5460
6 SASI_Rn02_00276194 predicted 5769
7 SASI_Rn02_00276195 predicted 5489
8 SASI_Rn02_00276196 predicted 5758
9 SASI_Rn02_00276197 predicted 5766
10 SASI_Rn02_00276198 predicted 5189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077400
FER1L5 MISSION shRNA Bacterial Glycerol Stock
fer-1-like 5 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-2205s21c1
Sequence:CCGGTTATGGTCATATCGATTATAGCTCGAGCTATAATCGATATGACCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-2247s21c1
Sequence:CCGGTCTATTCAGCTCCGCACTATTCTCGAGAATAGTGCGGAGCTGAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-420s21c1
Sequence:CCGGTCTGGTTCAAGTCCAGTAAAGCTCGAGCTTTACTGGACTTGAACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-1741s21c1
Sequence:CCGGGAAGTTCCCAGCCCGACTTATCTCGAGATAAGTCGGGCTGGGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-974s21c1
Sequence:CCGGCTCTATGACTTCGACCTATTTCTCGAGAAATAGGTCGAAGTCATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077400
FER1L5 MISSION shRNA shRNA Plasmid DNA
fer-1-like 5 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-2205s21c1
Sequence:CCGGTTATGGTCATATCGATTATAGCTCGAGCTATAATCGATATGACCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-2247s21c1
Sequence:CCGGTCTATTCAGCTCCGCACTATTCTCGAGAATAGTGCGGAGCTGAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-420s21c1
Sequence:CCGGTCTGGTTCAAGTCCAGTAAAGCTCGAGCTTTACTGGACTTGAACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-1741s21c1
Sequence:CCGGGAAGTTCCCAGCCCGACTTATCTCGAGATAAGTCGGGCTGGGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-974s21c1
Sequence:CCGGCTCTATGACTTCGACCTATTTCTCGAGAAATAGGTCGAAGTCATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077400
FER1L5 MISSION shRNA Lentiviral Transduction Particles
fer-1-like 5 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-2205s21c1
Sequence:CCGGTTATGGTCATATCGATTATAGCTCGAGCTATAATCGATATGACCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-2247s21c1
Sequence:CCGGTCTATTCAGCTCCGCACTATTCTCGAGAATAGTGCGGAGCTGAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-420s21c1
Sequence:CCGGTCTGGTTCAAGTCCAGTAAAGCTCGAGCTTTACTGGACTTGAACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-1741s21c1
Sequence:CCGGGAAGTTCCCAGCCCGACTTATCTCGAGATAAGTCGGGCTGGGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077400.1-974s21c1
Sequence:CCGGCTCTATGACTTCGACCTATTTCTCGAGAAATAGGTCGAAGTCATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)