EMAIL THIS PAGE TO A FRIEND

FER1L6-AS2

FER1L6 antisense RNA 2

25 Gene Product Result for
Synonyms: C8orf78
Species: Human FER1L6-AS2(157376)
UniProtKB ID: Q96M78
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182525 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182525 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131097 predicted 803
2 SASI_Hs01_00131098 predicted 828
3 SASI_Hs01_00131099 predicted 928
4 SASI_Hs01_00131100 predicted 746
5 SASI_Hs01_00131101 predicted 521
6 SASI_Hs01_00131102 predicted 758
7 SASI_Hs01_00131103 predicted 821
8 SASI_Hs01_00131104 predicted 736
9 SASI_Hs01_00131105 predicted 461
10 SASI_Hs01_00131106 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182525
FER1L6-AS2 MISSION shRNA Bacterial Glycerol Stock
FER1L6 antisense RNA 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182525.1-713s1c1
Sequence:CCGGCGCACAAGACATATTCTCGTTCTCGAGAACGAGAATATGTCTTGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182525.1-455s1c1
Sequence:CCGGCAGGAAAGAACTGCACAGCTTCTCGAGAAGCTGTGCAGTTCTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182525.1-842s1c1
Sequence:CCGGCCCAGATCAAGAAGCTGGTAACTCGAGTTACCAGCTTCTTGATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182525.1-305s1c1
Sequence:CCGGCACCTTCTTCATTTCCCGAACCTCGAGGTTCGGGAAATGAAGAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-307s1c1
Sequence:CCGGCCTTCTTCATTTCCCGAACTCCTCGAGGAGTTCGGGAAATGAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-329s1c1
Sequence:CCGGCCAGAAGAGAACCTGAGGAAACTCGAGTTTCCTCAGGTTCTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-203s1c1
Sequence:CCGGGCTGAAGTTCGGGTTGTTCTTCTCGAGAAGAACAACCCGAACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182525
FER1L6-AS2 MISSION shRNA shRNA Plasmid DNA
FER1L6 antisense RNA 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182525.1-713s1c1
Sequence:CCGGCGCACAAGACATATTCTCGTTCTCGAGAACGAGAATATGTCTTGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182525.1-455s1c1
Sequence:CCGGCAGGAAAGAACTGCACAGCTTCTCGAGAAGCTGTGCAGTTCTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182525.1-842s1c1
Sequence:CCGGCCCAGATCAAGAAGCTGGTAACTCGAGTTACCAGCTTCTTGATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182525.1-305s1c1
Sequence:CCGGCACCTTCTTCATTTCCCGAACCTCGAGGTTCGGGAAATGAAGAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-307s1c1
Sequence:CCGGCCTTCTTCATTTCCCGAACTCCTCGAGGAGTTCGGGAAATGAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-329s1c1
Sequence:CCGGCCAGAAGAGAACCTGAGGAAACTCGAGTTTCCTCAGGTTCTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-203s1c1
Sequence:CCGGGCTGAAGTTCGGGTTGTTCTTCTCGAGAAGAACAACCCGAACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182525
FER1L6-AS2 MISSION shRNA Lentiviral Transduction Particles
FER1L6 antisense RNA 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143026    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182525.1-713s1c1
Sequence:CCGGCGCACAAGACATATTCTCGTTCTCGAGAACGAGAATATGTCTTGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182525.1-455s1c1
Sequence:CCGGCAGGAAAGAACTGCACAGCTTCTCGAGAAGCTGTGCAGTTCTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182525.1-842s1c1
Sequence:CCGGCCCAGATCAAGAAGCTGGTAACTCGAGTTACCAGCTTCTTGATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182525.1-305s1c1
Sequence:CCGGCACCTTCTTCATTTCCCGAACCTCGAGGTTCGGGAAATGAAGAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-307s1c1
Sequence:CCGGCCTTCTTCATTTCCCGAACTCCTCGAGGAGTTCGGGAAATGAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-329s1c1
Sequence:CCGGCCAGAAGAGAACCTGAGGAAACTCGAGTTTCCTCAGGTTCTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182525.1-203s1c1
Sequence:CCGGGCTGAAGTTCGGGTTGTTCTTCTCGAGAAGAACAACCCGAACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)