EMAIL THIS PAGE TO A FRIEND

FER1L6

fer-1-like 6 (C. elegans)

Synonyms: C8ORFK23
UniProtKB ID: Q2WGJ9
Gene ID:
Mouse(631797) fer-1-like 6 (C. elegans)
Rat(314997) fer-1-like 6 (C. elegans)
Zebrafish(100535460) fer-1-like 6 (C. elegans)
cow(527366) fer-1-like 6 (C. elegans)
Horse(100057581) fer-1-like 6 (C. elegans)
domestic cat(101084934) fer-1-like 6 (C. elegans)
dog(482036) fer-1-like 6 (C. elegans)
chicken(420340) fer-1-like 6 (C. elegans)
naked mole-rat(101716891) fer-1-like 6 (C. elegans)
domestic guinea pig(100725641) fer-1-like 6 (C. elegans)
sheep(101106949) fer-1-like 6 (C. elegans)
Domestic Rabbit(100356695) fer-1-like 6 (C. elegans)
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039112 Rosetta Predictions human pricing
XM_001068781 Rosetta Predictions rat pricing
XM_235335 Rosetta Predictions rat pricing
XM_905719 Rosetta Predictions mouse pricing
XM_977315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308427 predicted 1690
2 SASI_Hs01_00175047 predicted 3523
3 SASI_Hs02_00308428 predicted 4340
4 SASI_Hs01_00175050 predicted 4497
5 SASI_Hs01_00175051 predicted 4630
6 SASI_Hs02_00308429 predicted 3298
7 SASI_Hs01_00175054 predicted 1924
8 SASI_Hs02_00308430 predicted 3115
9 SASI_Hs02_00308431 predicted 1662
10 SASI_Hs02_00308432 predicted 510
11 SASI_Hs01_00175046 predicted 3445
12 SASI_Hs01_00175048 predicted 811
13 SASI_Hs01_00175049 predicted 3801
14 SASI_Hs01_00175052 predicted 1767
15 SASI_Hs01_00175053 predicted 4374
16 SASI_Hs01_00175055 predicted 3795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325820 predicted 1567
2 SASI_Rn02_00325821 predicted 3679
3 SASI_Rn02_00325822 predicted 4169
4 SASI_Rn02_00325823 predicted 2481
5 SASI_Rn02_00325824 predicted 205
6 SASI_Rn02_00325825 predicted 4137
7 SASI_Rn02_00325826 predicted 3901
8 SASI_Rn02_00325827 predicted 4789
9 SASI_Rn02_00325828 predicted 612
10 SASI_Rn02_00325829 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389177 predicted 1566
2 SASI_Rn02_00389178 predicted 3680
3 SASI_Rn02_00389179 predicted 4168
4 SASI_Rn02_00389180 predicted 2486
5 SASI_Rn02_00389181 predicted 202
6 SASI_Rn02_00389182 predicted 4142
7 SASI_Rn02_00389183 predicted 3902
8 SASI_Rn02_00389184 predicted 4791
9 SASI_Rn02_00389185 predicted 613
10 SASI_Rn02_00389186 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432030 predicted 601
2 SASI_Mm02_00432031 predicted 1269
3 SASI_Mm02_00432032 predicted 289
4 SASI_Mm02_00432033 predicted 523
5 SASI_Mm02_00432034 predicted 2439
6 SASI_Mm02_00432035 predicted 1913
7 SASI_Mm02_00432036 predicted 5375
8 SASI_Mm02_00432037 predicted 4390
9 SASI_Mm02_00432038 predicted 3371
10 SASI_Mm02_00432039 predicted 4150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209639 predicted 600
2 SASI_Mm01_00209640 predicted 1266
3 SASI_Mm01_00209641 predicted 288
4 SASI_Mm02_00446276 predicted 521
5 SASI_Mm01_00209643 predicted 2445
6 SASI_Mm01_00209644 predicted 1919
7 SASI_Mm01_00209645 predicted 5368
8 SASI_Mm01_00209646 predicted 4390
9 SASI_Mm01_00209647 predicted 3365
10 SASI_Mm01_00209648 predicted 4152
11 SASI_Mm01_00209642 predicted 2280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039112
FER1L6 MISSION shRNA Bacterial Glycerol Stock
fer-1-like 6 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-4622s21c1
Sequence:CCGGCACGTCCAAACCCACCGAAATCTCGAGATTTCGGTGGGTTTGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-4413s21c1
Sequence:CCGGCCAGTATTTGGAAGGTCATTTCTCGAGAAATGACCTTCCAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039112.2-5793s21c1
Sequence:CCGGGACCCAGATCCTCGCCATATACTCGAGTATATGGCGAGGATCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-1428s21c1
Sequence:CCGGGGACGGGCACAGGAATCTAAACTCGAGTTTAGATTCCTGTGCCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-3838s21c1
Sequence:CCGGTTGACTGGTGGTCTAAGTATTCTCGAGAATACTTAGACCACCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039112
FER1L6 MISSION shRNA shRNA Plasmid DNA
fer-1-like 6 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-4622s21c1
Sequence:CCGGCACGTCCAAACCCACCGAAATCTCGAGATTTCGGTGGGTTTGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-4413s21c1
Sequence:CCGGCCAGTATTTGGAAGGTCATTTCTCGAGAAATGACCTTCCAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039112.2-5793s21c1
Sequence:CCGGGACCCAGATCCTCGCCATATACTCGAGTATATGGCGAGGATCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-1428s21c1
Sequence:CCGGGGACGGGCACAGGAATCTAAACTCGAGTTTAGATTCCTGTGCCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-3838s21c1
Sequence:CCGGTTGACTGGTGGTCTAAGTATTCTCGAGAATACTTAGACCACCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039112
FER1L6 MISSION shRNA Lentiviral Transduction Particles
fer-1-like 6 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-4622s21c1
Sequence:CCGGCACGTCCAAACCCACCGAAATCTCGAGATTTCGGTGGGTTTGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-4413s21c1
Sequence:CCGGCCAGTATTTGGAAGGTCATTTCTCGAGAAATGACCTTCCAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039112.2-5793s21c1
Sequence:CCGGGACCCAGATCCTCGCCATATACTCGAGTATATGGCGAGGATCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-1428s21c1
Sequence:CCGGGGACGGGCACAGGAATCTAAACTCGAGTTTAGATTCCTGTGCCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039112.2-3838s21c1
Sequence:CCGGTTGACTGGTGGTCTAAGTATTCTCGAGAATACTTAGACCACCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks