EMAIL THIS PAGE TO A FRIEND

FER

fer (fps/fes related) tyrosine kinase

43 Gene Product Result for
Synonyms: FerT PPP1R74 TYK3
UniProtKB ID: P16591, B2RCR4, B4DSQ2, H2FLB8
Gene ID:
Human(2241) Summary: Fer protein is a member of the FPS/FES family of nontransmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. [provided by RefSeq, Jul 2008]
Mouse(103921) ferris
Zebrafish(565199) fer (fps/fes related) tyrosine kinase
cow(536759) fer (fps/fes related) tyrosine kinase
domestic cat(101094235) fer (fps/fes related) tyrosine kinase
dog(403754) fer (fps/fes related) tyrosine kinase
chicken(415614) fer (fps/fes related) tyrosine kinase
Thale Cress(824318) receptor-like protein kinase FERONIA
sheep(101116052) fer (fps/fes related) tyrosine kinase
Domestic Rabbit(100358428) fer (fps/fes related) tyrosine kinase
domestic guinea pig(101787786) fer (fps/fes related) tyrosine kinase
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0960 Phosphotyrosine FER / Tyrosine-protein Kinase Fer ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005246 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011991 MISSION® esiRNA esiRNA targeting human FER (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005246 siRNAs that have been validated in the lab human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005246 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059884 validated 1526
1 SASI_Hs01_00059885 validated 1558
2 SASI_Hs02_00339260 predicted 2582
3 SASI_Hs01_00059887 predicted 619
4 SASI_Hs01_00059888 predicted 900
5 SASI_Hs02_00339261 predicted 1176
6 SASI_Hs02_00339262 predicted 1643
7 SASI_Hs02_00339263 predicted 435
8 SASI_Hs01_00059890 predicted 2106
9 SASI_Hs01_00059891 predicted 2389
10 SASI_Hs01_00059892 predicted 1422
11 SASI_Hs01_00059886 predicted 2534
12 SASI_Hs01_00059889 predicted 1025
13 SASI_Hs01_00059893 predicted 941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005246
FER MISSION shRNA Bacterial Glycerol Stock
fer (fps/fes related) tyrosine kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-2733s1c1
Sequence:CCGGGCACTGTCCAGAGGATATTTCCTCGAGGAAATATCCTCTGGACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-1949s1c1
Sequence:CCGGCAAACATTCCTCAACTTATAGCTCGAGCTATAAGTTGAGGAATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-617s1c1
Sequence:CCGGCAGAACAACTTAGTAGGATAACTCGAGTTATCCTACTAAGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-1288s1c1
Sequence:CCGGGCAGAAAGTTTGCAAGTAATGCTCGAGCATTACTTGCAAACTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-2693s1c1
Sequence:CCGGGAGAGCAAGTAGAAAGAGGATCTCGAGATCCTCTTTCTACTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-883s1c1
Sequence:CCGGGCCAAGGAACGATACGACAAACTCGAGTTTGTCGTATCGTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-1570s1c1
Sequence:CCGGCCACCTCCAGTAGTAAATTATCTCGAGATAATTTACTACTGGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-1193s1c1
Sequence:CCGGCGGCTGCTAAAGAACAAGAAACTCGAGTTTCTTGTTCTTTAGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-934s1c1
Sequence:CCGGCAGTATGTATTGGCGTTGAAACTCGAGTTTCAACGCCAATACATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005246
FER MISSION shRNA shRNA Plasmid DNA
fer (fps/fes related) tyrosine kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-2733s1c1
Sequence:CCGGGCACTGTCCAGAGGATATTTCCTCGAGGAAATATCCTCTGGACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-1949s1c1
Sequence:CCGGCAAACATTCCTCAACTTATAGCTCGAGCTATAAGTTGAGGAATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-617s1c1
Sequence:CCGGCAGAACAACTTAGTAGGATAACTCGAGTTATCCTACTAAGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-1288s1c1
Sequence:CCGGGCAGAAAGTTTGCAAGTAATGCTCGAGCATTACTTGCAAACTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-2693s1c1
Sequence:CCGGGAGAGCAAGTAGAAAGAGGATCTCGAGATCCTCTTTCTACTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-883s1c1
Sequence:CCGGGCCAAGGAACGATACGACAAACTCGAGTTTGTCGTATCGTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-1570s1c1
Sequence:CCGGCCACCTCCAGTAGTAAATTATCTCGAGATAATTTACTACTGGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-1193s1c1
Sequence:CCGGCGGCTGCTAAAGAACAAGAAACTCGAGTTTCTTGTTCTTTAGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-934s1c1
Sequence:CCGGCAGTATGTATTGGCGTTGAAACTCGAGTTTCAACGCCAATACATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005246
FER MISSION shRNA Lentiviral Transduction Particles
fer (fps/fes related) tyrosine kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-2733s1c1
Sequence:CCGGGCACTGTCCAGAGGATATTTCCTCGAGGAAATATCCTCTGGACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-1949s1c1
Sequence:CCGGCAAACATTCCTCAACTTATAGCTCGAGCTATAAGTTGAGGAATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-617s1c1
Sequence:CCGGCAGAACAACTTAGTAGGATAACTCGAGTTATCCTACTAAGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005246.1-1288s1c1
Sequence:CCGGGCAGAAAGTTTGCAAGTAATGCTCGAGCATTACTTGCAAACTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-2693s1c1
Sequence:CCGGGAGAGCAAGTAGAAAGAGGATCTCGAGATCCTCTTTCTACTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-883s1c1
Sequence:CCGGGCCAAGGAACGATACGACAAACTCGAGTTTGTCGTATCGTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-1570s1c1
Sequence:CCGGCCACCTCCAGTAGTAAATTATCTCGAGATAATTTACTACTGGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-1193s1c1
Sequence:CCGGCGGCTGCTAAAGAACAAGAAACTCGAGTTTCTTGTTCTTTAGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005246.x-934s1c1
Sequence:CCGGCAGTATGTATTGGCGTTGAAACTCGAGTTTCAACGCCAATACATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks