EMAIL THIS PAGE TO A FRIEND

FERD3L

Fer3-like (Drosophila)

45 Gene Product Result for
Synonyms: N-TWIST NATO3 NTWIST bHLHa31
UniProtKB ID: Q96RJ6, Q495K0
Gene ID:
Mouse(114712) Fer3-like (Drosophila)
Rat(366598) Fer3-like (Drosophila)
chicken(428429) Fer3-like (Drosophila)
cow(538985) Fer3-like (Drosophila)
dog(482340) Fer3-like (Drosophila)
domestic cat(101086712) Fer3-like (Drosophila)
sheep(101119717) Fer3-like (Drosophila)
domestic guinea pig(100734534) Fer3-like (Drosophila)
naked mole-rat(101705228) Fer3-like (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152898 Rosetta Predictions human pricing
NM_001108980 Rosetta Predictions rat pricing
NM_033522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203084 predicted 439
2 SASI_Hs01_00203085 predicted 383
3 SASI_Hs01_00203086 predicted 494
4 SASI_Hs01_00203088 predicted 516
5 SASI_Hs01_00203089 predicted 372
6 SASI_Hs01_00203090 predicted 548
7 SASI_Hs01_00203091 predicted 517
8 SASI_Hs01_00203092 predicted 417
9 SASI_Hs01_00203093 predicted 487
10 SASI_Hs02_00366864 predicted 366
11 SASI_Hs01_00203087 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243984 predicted 209
2 SASI_Rn02_00243985 predicted 214
3 SASI_Rn02_00243986 predicted 291
4 SASI_Rn02_00243987 predicted 354
5 SASI_Rn02_00243988 predicted 357
6 SASI_Rn02_00243989 predicted 301
7 SASI_Rn02_00243990 predicted 253
8 SASI_Rn02_00243991 predicted 252
9 SASI_Rn02_00243992 predicted 679
10 SASI_Rn02_00243993 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069228 predicted 225
2 SASI_Mm01_00069229 predicted 224
3 SASI_Mm01_00069230 predicted 220
4 SASI_Mm02_00337381 predicted 447
5 SASI_Mm01_00069231 predicted 450
6 SASI_Mm01_00069232 predicted 220
7 SASI_Mm01_00069233 predicted 512
8 SASI_Mm01_00069234 predicted 385
9 SASI_Mm01_00069235 predicted 507
10 SASI_Mm01_00069236 predicted 349
11 SASI_Mm01_00069237 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152898
FERD3L MISSION shRNA Bacterial Glycerol Stock
Fer3-like (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-444s1c1
Sequence:CCGGCCCACGTTTGCTTACGAGAAACTCGAGTTTCTCGTAAGCAAACGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-141s1c1
Sequence:CCGGCCTCTCCTCTGCGACTTCGCACTCGAGTGCGAAGTCGCAGAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-380s1c1
Sequence:CCGGCATCCGCGAAAGGAAGCGGATCTCGAGATCCGCTTCCTTTCGCGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-305s1c1
Sequence:CCGGCGGAAGAGGTGTCTCCCTATTCTCGAGAATAGGGAGACACCTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-374s1c1
Sequence:CCGGCGCCAACATCCGCGAAAGGAACTCGAGTTCCTTTCGCGGATGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-245s21c1
Sequence:CCGGAGAAGAAGAGGAGTGCGAAGTCTCGAGACTTCGCACTCCTCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-420s21c1
Sequence:CCGGTTTGACCAGCTGCGGAGGAAGCTCGAGCTTCCTCCGCAGCTGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-100s21c1
Sequence:CCGGTGGACTTCGTCGCAGACCTGTCTCGAGACAGGTCTGCGACGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-88s21c1
Sequence:CCGGACACTACGGTGCTGGACTTCGCTCGAGCGAAGTCCAGCACCGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152898
FERD3L MISSION shRNA shRNA Plasmid DNA
Fer3-like (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-444s1c1
Sequence:CCGGCCCACGTTTGCTTACGAGAAACTCGAGTTTCTCGTAAGCAAACGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-141s1c1
Sequence:CCGGCCTCTCCTCTGCGACTTCGCACTCGAGTGCGAAGTCGCAGAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-380s1c1
Sequence:CCGGCATCCGCGAAAGGAAGCGGATCTCGAGATCCGCTTCCTTTCGCGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-305s1c1
Sequence:CCGGCGGAAGAGGTGTCTCCCTATTCTCGAGAATAGGGAGACACCTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-374s1c1
Sequence:CCGGCGCCAACATCCGCGAAAGGAACTCGAGTTCCTTTCGCGGATGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-245s21c1
Sequence:CCGGAGAAGAAGAGGAGTGCGAAGTCTCGAGACTTCGCACTCCTCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-420s21c1
Sequence:CCGGTTTGACCAGCTGCGGAGGAAGCTCGAGCTTCCTCCGCAGCTGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-100s21c1
Sequence:CCGGTGGACTTCGTCGCAGACCTGTCTCGAGACAGGTCTGCGACGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-88s21c1
Sequence:CCGGACACTACGGTGCTGGACTTCGCTCGAGCGAAGTCCAGCACCGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152898
FERD3L MISSION shRNA Lentiviral Transduction Particles
Fer3-like (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-444s1c1
Sequence:CCGGCCCACGTTTGCTTACGAGAAACTCGAGTTTCTCGTAAGCAAACGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-141s1c1
Sequence:CCGGCCTCTCCTCTGCGACTTCGCACTCGAGTGCGAAGTCGCAGAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-380s1c1
Sequence:CCGGCATCCGCGAAAGGAAGCGGATCTCGAGATCCGCTTCCTTTCGCGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-305s1c1
Sequence:CCGGCGGAAGAGGTGTCTCCCTATTCTCGAGAATAGGGAGACACCTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152898.2-374s1c1
Sequence:CCGGCGCCAACATCCGCGAAAGGAACTCGAGTTCCTTTCGCGGATGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-245s21c1
Sequence:CCGGAGAAGAAGAGGAGTGCGAAGTCTCGAGACTTCGCACTCCTCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-420s21c1
Sequence:CCGGTTTGACCAGCTGCGGAGGAAGCTCGAGCTTCCTCCGCAGCTGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-100s21c1
Sequence:CCGGTGGACTTCGTCGCAGACCTGTCTCGAGACAGGTCTGCGACGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152898.2-88s21c1
Sequence:CCGGACACTACGGTGCTGGACTTCGCTCGAGCGAAGTCCAGCACCGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033522
FERD3L MISSION shRNA Bacterial Glycerol Stock
Fer3-like (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-102s1c1
Sequence:CCGGGTGCTGAACTTCGTAGCAGATCTCGAGATCTGCTACGAAGTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-228s1c1
Sequence:CCGGTCGCAGTTTGATGAAAGATATCTCGAGATATCTTTCATCAAACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-216s1c1
Sequence:CCGGCCTGGGAGACTGTCGCAGTTTCTCGAGAAACTGCGACAGTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-413s1c1
Sequence:CCGGGTTCAACCTAAACGAGGCCTTCTCGAGAAGGCCTCGTTTAGGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-502s1c1
Sequence:CCGGGCTTGGCCATCGTCTACATTTCTCGAGAAATGTAGACGATGGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033522.2-357s21c1
Sequence:CCGGAGAGTTATTACTTATGCCCAGCTCGAGCTGGGCATAAGTAATAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033522.2-143s21c1
Sequence:CCGGACACCCTCTTCTCTGCGAGTTCTCGAGAACTCGCAGAGAAGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033522
FERD3L MISSION shRNA shRNA Plasmid DNA
Fer3-like (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-102s1c1
Sequence:CCGGGTGCTGAACTTCGTAGCAGATCTCGAGATCTGCTACGAAGTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-228s1c1
Sequence:CCGGTCGCAGTTTGATGAAAGATATCTCGAGATATCTTTCATCAAACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-216s1c1
Sequence:CCGGCCTGGGAGACTGTCGCAGTTTCTCGAGAAACTGCGACAGTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-413s1c1
Sequence:CCGGGTTCAACCTAAACGAGGCCTTCTCGAGAAGGCCTCGTTTAGGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-502s1c1
Sequence:CCGGGCTTGGCCATCGTCTACATTTCTCGAGAAATGTAGACGATGGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033522.2-357s21c1
Sequence:CCGGAGAGTTATTACTTATGCCCAGCTCGAGCTGGGCATAAGTAATAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033522.2-143s21c1
Sequence:CCGGACACCCTCTTCTCTGCGAGTTCTCGAGAACTCGCAGAGAAGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033522
FERD3L MISSION shRNA Lentiviral Transduction Particles
Fer3-like (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-102s1c1
Sequence:CCGGGTGCTGAACTTCGTAGCAGATCTCGAGATCTGCTACGAAGTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-228s1c1
Sequence:CCGGTCGCAGTTTGATGAAAGATATCTCGAGATATCTTTCATCAAACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-216s1c1
Sequence:CCGGCCTGGGAGACTGTCGCAGTTTCTCGAGAAACTGCGACAGTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-413s1c1
Sequence:CCGGGTTCAACCTAAACGAGGCCTTCTCGAGAAGGCCTCGTTTAGGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033522.2-502s1c1
Sequence:CCGGGCTTGGCCATCGTCTACATTTCTCGAGAAATGTAGACGATGGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033522.2-357s21c1
Sequence:CCGGAGAGTTATTACTTATGCCCAGCTCGAGCTGGGCATAAGTAATAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033522.2-143s21c1
Sequence:CCGGACACCCTCTTCTCTGCGAGTTCTCGAGAACTCGCAGAGAAGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks