EMAIL THIS PAGE TO A FRIEND

FERMT1

fermitin family member 1

150 Gene Product Result for
Synonyms: C20orf42 DTGCU2 KIND1 UNC112A URP1
UniProtKB ID: Q9BQL6, D3DW10, Q8IX34, Q8IYH2, Q9NWM2, Q9NXQ3
Gene ID:
Human(55612) Summary: This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
Mouse(241639) fermitin family homolog 1 (Drosophila)
Rat(296179) fermitin family member 1
Zebrafish(100332544) fermitin family member 1
cow(524427) fermitin family member 1
Horse(100051761) fermitin family member 1
domestic cat(101082227) fermitin family member 1
dog(485775) fermitin family member 1
chicken(416727) fermitin family member 1
naked mole-rat(101721311) fermitin family member 1
domestic guinea pig(100732971) fermitin family member 1
sheep(101117180) fermitin family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017671 Rosetta Predictions human pricing
NM_001106515 Rosetta Predictions rat pricing
NM_198029 Rosetta Predictions mouse pricing
XM_141372 Rosetta Predictions mouse pricing
XM_894922 Rosetta Predictions mouse pricing
XM_902117 Rosetta Predictions mouse pricing
XM_902119 Rosetta Predictions mouse pricing
XM_902122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210469 predicted 2896
2 SASI_Hs01_00210470 predicted 1879
3 SASI_Hs01_00210471 predicted 2147
4 SASI_Hs01_00210472 predicted 2523
5 SASI_Hs01_00210473 predicted 2538
6 SASI_Hs01_00210475 predicted 1520
7 SASI_Hs01_00210476 predicted 905
8 SASI_Hs01_00210478 predicted 2883
9 SASI_Hs02_00350400 predicted 864
10 SASI_Hs02_00350401 predicted 1316
11 SASI_Hs01_00210474 predicted 2595
12 SASI_Hs01_00210477 predicted 2669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219718 predicted 1597
2 SASI_Rn02_00219719 predicted 1663
3 SASI_Rn02_00219720 predicted 1683
4 SASI_Rn02_00219721 predicted 1767
5 SASI_Rn02_00219722 predicted 2478
6 SASI_Rn02_00219723 predicted 2493
7 SASI_Rn02_00219724 predicted 1345
8 SASI_Rn02_00219725 predicted 2270
9 SASI_Rn02_00219726 predicted 2106
10 SASI_Rn02_00219727 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350767 predicted 1822
2 SASI_Mm02_00350768 predicted 1991
3 SASI_Mm02_00350769 predicted 1953
4 SASI_Mm02_00350770 predicted 1408
5 SASI_Mm02_00350771 predicted 1906
6 SASI_Mm02_00350772 predicted 2856
7 SASI_Mm02_00350773 predicted 1836
8 SASI_Mm02_00350774 predicted 1803
9 SASI_Mm02_00350775 predicted 1979
10 SASI_Mm02_00350776 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268069 predicted 2599
2 SASI_Mm01_00268070 predicted 2557
3 SASI_Mm01_00268071 predicted 3436
4 SASI_Mm01_00268072 predicted 2517
5 SASI_Mm01_00268073 predicted 3462
6 SASI_Mm01_00268074 predicted 3040
7 SASI_Mm01_00268075 predicted 2582
8 SASI_Mm01_00268076 predicted 2788
9 SASI_Mm01_00268077 predicted 3398
10 SASI_Mm01_00268078 predicted 3239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215519 predicted 1851
2 SASI_Mm01_00215520 predicted 2022
3 SASI_Mm01_00215521 predicted 1982
4 SASI_Mm01_00215522 predicted 1435
5 SASI_Mm01_00215523 predicted 1944
6 SASI_Mm01_00215524 predicted 1867
7 SASI_Mm01_00215525 predicted 1840
8 SASI_Mm01_00215526 predicted 2009
9 SASI_Mm01_00215527 predicted 1524
10 SASI_Mm01_00215528 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247743 predicted 1820
2 SASI_Mm01_00247744 predicted 1995
3 SASI_Mm01_00247745 predicted 1953
4 SASI_Mm01_00247746 predicted 1412
5 SASI_Mm01_00247747 predicted 1918
6 SASI_Mm01_00247748 predicted 1836
7 SASI_Mm01_00247749 predicted 1809
8 SASI_Mm01_00247750 predicted 1991
9 SASI_Mm01_00247751 predicted 1500
10 SASI_Mm01_00247752 predicted 2191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237192 predicted 809
2 SASI_Mm01_00237193 predicted 736
3 SASI_Mm01_00237194 predicted 908
4 SASI_Mm01_00237195 predicted 776
5 SASI_Mm01_00237196 predicted 894
6 SASI_Mm01_00237197 predicted 1081
7 SASI_Mm01_00237198 predicted 1079
8 SASI_Mm01_00237199 predicted 905
9 SASI_Mm01_00237200 predicted 809
10 SASI_Mm01_00237201 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275600 predicted 1758
2 SASI_Mm01_00275601 predicted 1952
3 SASI_Mm01_00275602 predicted 1902
4 SASI_Mm01_00275603 predicted 1869
5 SASI_Mm01_00275604 predicted 1790
6 SASI_Mm01_00275605 predicted 1771
7 SASI_Mm01_00275606 predicted 1745
8 SASI_Mm01_00275607 predicted 1940
9 SASI_Mm01_00275608 predicted 1433
10 SASI_Mm01_00275609 predicted 2138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017671
FERMT1 MISSION shRNA Bacterial Glycerol Stock
fermitin family member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017671.4-1253s21c1
Sequence:CCGGATAATAAGGAACCCATAATTGCTCGAGCAATTATGGGTTCCTTATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017671.4-1587s21c1
Sequence:CCGGGCAGCTGCTCTTACGATTTAACTCGAGTTAAATCGTAAGAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-2492s1c1
Sequence:CCGGCCTACTACCTTGTCAGATTTACTCGAGTAAATCTGACAAGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-918s1c1
Sequence:CCGGGCTCAAGTTAGTAGAACAGATCTCGAGATCTGTTCTACTAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017671.3-4733s1c1
Sequence:CCGGGCTGAGAACATCTCTGCCTAACTCGAGTTAGGCAGAGATGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-1741s1c1
Sequence:CCGGCTACAGTACCACATTAGCAAACTCGAGTTTGCTAATGTGGTACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-1826s1c1
Sequence:CCGGCGCTTTCTAATTTGGAAGTAACTCGAGTTACTTCCAAATTAGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017671
FERMT1 MISSION shRNA shRNA Plasmid DNA
fermitin family member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017671.4-1253s21c1
Sequence:CCGGATAATAAGGAACCCATAATTGCTCGAGCAATTATGGGTTCCTTATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017671.4-1587s21c1
Sequence:CCGGGCAGCTGCTCTTACGATTTAACTCGAGTTAAATCGTAAGAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-2492s1c1
Sequence:CCGGCCTACTACCTTGTCAGATTTACTCGAGTAAATCTGACAAGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-918s1c1
Sequence:CCGGGCTCAAGTTAGTAGAACAGATCTCGAGATCTGTTCTACTAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017671.3-4733s1c1
Sequence:CCGGGCTGAGAACATCTCTGCCTAACTCGAGTTAGGCAGAGATGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-1741s1c1
Sequence:CCGGCTACAGTACCACATTAGCAAACTCGAGTTTGCTAATGTGGTACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-1826s1c1
Sequence:CCGGCGCTTTCTAATTTGGAAGTAACTCGAGTTACTTCCAAATTAGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017671
FERMT1 MISSION shRNA Lentiviral Transduction Particles
fermitin family member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017671.4-1253s21c1
Sequence:CCGGATAATAAGGAACCCATAATTGCTCGAGCAATTATGGGTTCCTTATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017671.4-1587s21c1
Sequence:CCGGGCAGCTGCTCTTACGATTTAACTCGAGTTAAATCGTAAGAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-2492s1c1
Sequence:CCGGCCTACTACCTTGTCAGATTTACTCGAGTAAATCTGACAAGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-918s1c1
Sequence:CCGGGCTCAAGTTAGTAGAACAGATCTCGAGATCTGTTCTACTAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017671.3-4733s1c1
Sequence:CCGGGCTGAGAACATCTCTGCCTAACTCGAGTTAGGCAGAGATGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-1741s1c1
Sequence:CCGGCTACAGTACCACATTAGCAAACTCGAGTTTGCTAATGTGGTACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017671.3-1826s1c1
Sequence:CCGGCGCTTTCTAATTTGGAAGTAACTCGAGTTACTTCCAAATTAGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198029
FERMT1 MISSION shRNA Bacterial Glycerol Stock
fermitin family member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-660s1c1
Sequence:CCGGGTGGAGATTCGCCAATATGAACTCGAGTTCATATTGGCGAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-312s1c1
Sequence:CCGGCAGCATCCTTTCGTTTCTCAACTCGAGTTGAGAAACGAAAGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-844s1c1
Sequence:CCGGGATGAGGACCTCTTCCACAAACTCGAGTTTGTGGAAGAGGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-302s1c1
Sequence:CCGGCAGAGGTCATCAGCATCCTTTCTCGAGAAAGGATGCTGATGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-780s1c1
Sequence:CCGGCCATGAGTACATTGGTGGCTACTCGAGTAGCCACCAATGTACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-552s1c1
Sequence:CCGGCACCTACTACCTTGTCAGATTCTCGAGAATCTGACAAGGTAGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-318s1c1
Sequence:CCGGCCTTTCGTTTCTCAAGATGAACTCGAGTTCATCTTGAGAAACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-757s1c1
Sequence:CCGGCTAAGTGCAGATTGCAAGATTCTCGAGAATCTTGCAATCTGCACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198029
FERMT1 MISSION shRNA shRNA Plasmid DNA
fermitin family member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-660s1c1
Sequence:CCGGGTGGAGATTCGCCAATATGAACTCGAGTTCATATTGGCGAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-312s1c1
Sequence:CCGGCAGCATCCTTTCGTTTCTCAACTCGAGTTGAGAAACGAAAGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-844s1c1
Sequence:CCGGGATGAGGACCTCTTCCACAAACTCGAGTTTGTGGAAGAGGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-302s1c1
Sequence:CCGGCAGAGGTCATCAGCATCCTTTCTCGAGAAAGGATGCTGATGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-780s1c1
Sequence:CCGGCCATGAGTACATTGGTGGCTACTCGAGTAGCCACCAATGTACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-552s1c1
Sequence:CCGGCACCTACTACCTTGTCAGATTCTCGAGAATCTGACAAGGTAGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-318s1c1
Sequence:CCGGCCTTTCGTTTCTCAAGATGAACTCGAGTTCATCTTGAGAAACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-757s1c1
Sequence:CCGGCTAAGTGCAGATTGCAAGATTCTCGAGAATCTTGCAATCTGCACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198029
FERMT1 MISSION shRNA Lentiviral Transduction Particles
fermitin family member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-660s1c1
Sequence:CCGGGTGGAGATTCGCCAATATGAACTCGAGTTCATATTGGCGAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-312s1c1
Sequence:CCGGCAGCATCCTTTCGTTTCTCAACTCGAGTTGAGAAACGAAAGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-844s1c1
Sequence:CCGGGATGAGGACCTCTTCCACAAACTCGAGTTTGTGGAAGAGGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-302s1c1
Sequence:CCGGCAGAGGTCATCAGCATCCTTTCTCGAGAAAGGATGCTGATGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-780s1c1
Sequence:CCGGCCATGAGTACATTGGTGGCTACTCGAGTAGCCACCAATGTACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198029.1-552s1c1
Sequence:CCGGCACCTACTACCTTGTCAGATTCTCGAGAATCTGACAAGGTAGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-318s1c1
Sequence:CCGGCCTTTCGTTTCTCAAGATGAACTCGAGTTCATCTTGAGAAACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198029.1-757s1c1
Sequence:CCGGCTAAGTGCAGATTGCAAGATTCTCGAGAATCTTGCAATCTGCACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks