EMAIL THIS PAGE TO A FRIEND

FERMT2

fermitin family member 2

144 Gene Product Result for
Synonyms: KIND2 MIG2 PLEKHC1 UNC112 UNC112B mig-2
UniProtKB ID: Q96AC1, B5TJY2, Q14840, Q86TY7
Gene ID:
Mouse(218952) fermitin family homolog 2 (Drosophila)
Rat(289992) fermitin family member 2
sheep(101115796) fermitin family member 2
domestic guinea pig(100732488) fermitin family member 2
naked mole-rat(101714078) fermitin family member 2
Zebrafish(553051) fermitin family homolog 2 (Drosophila)
domestic cat(101099808) fermitin family member 2
cow(616981) fermitin family member 2
Horse(100049968) fermitin family member 2
dog(490693) fermitin family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006832 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006832 Rosetta Predictions human pricing
NM_001011915 Rosetta Predictions rat pricing
XM_573747 Rosetta Predictions rat pricing
NM_146054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174986 predicted 2111
2 SASI_Hs01_00174987 predicted 1770
3 SASI_Hs01_00174989 predicted 1960
4 SASI_Hs01_00174990 predicted 2006
5 SASI_Hs02_00342395 predicted 1712
6 SASI_Hs02_00342396 predicted 200
7 SASI_Hs01_00174992 predicted 1676
8 SASI_Hs01_00174993 predicted 1490
9 SASI_Hs01_00174995 predicted 1711
10 SASI_Hs02_00342397 predicted 2071
11 SASI_Hs01_00174988 predicted 1980
12 SASI_Hs01_00174991 predicted 793
13 SASI_Hs01_00174994 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121715 predicted 547
2 SASI_Rn01_00121717 predicted 2084
3 SASI_Rn01_00121718 predicted 494
4 SASI_Rn01_00121719 predicted 1363
5 SASI_Rn01_00121720 predicted 1103
6 SASI_Rn01_00121721 predicted 901
7 SASI_Rn01_00121722 predicted 1846
8 SASI_Rn01_00121723 predicted 1799
9 SASI_Rn01_00121724 predicted 800
10 SASI_Rn02_00199912 predicted 1264
11 SASI_Rn01_00121716 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148451 predicted 796
2 SASI_Rn01_00148452 predicted 815
3 SASI_Rn01_00148453 predicted 2341
4 SASI_Rn01_00148454 predicted 741
5 SASI_Rn01_00148455 predicted 1617
6 SASI_Rn01_00148456 predicted 1358
7 SASI_Rn01_00148457 predicted 1155
8 SASI_Rn01_00148458 predicted 2090
9 SASI_Rn01_00148459 predicted 2048
10 SASI_Rn01_00148460 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047490 predicted 1487
2 SASI_Mm01_00047491 predicted 907
3 SASI_Mm01_00047492 predicted 1252
4 SASI_Mm01_00047493 predicted 2213
5 SASI_Mm01_00047495 predicted 1351
6 SASI_Mm01_00047496 predicted 1416
7 SASI_Mm01_00047497 predicted 2240
8 SASI_Mm02_00341669 predicted 2229
9 SASI_Mm01_00047498 predicted 841
10 SASI_Mm01_00047499 predicted 1880
11 SASI_Mm01_00047494 predicted 1440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146054
VALIDATED
FERMT2 MISSION shRNA Bacterial Glycerol Stock
fermitin family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146054.1-380s1c1
Sequence:CCGGGAAGTATAAGAGCAAACAGATCTCGAGATCTGTTTGCTCTTATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-1014s1c1
Sequence:CCGGGCCTACCTTGATATGCCGTATCTCGAGATACGGCATATCAAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-798s1c1
Sequence:CCGGGATGAGGAGATGTTCTACAAACTCGAGTTTGTAGAACATCTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-1453s1c1
Sequence:CCGGGCCTTTGTGTTACAATATGAACTCGAGTTCATATTGTAACACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146054.2-1726s21c1
Sequence:CCGGGAAGTATAAGAGCAAACAGATCTCGAGATCTGTTTGCTCTTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146054.2-2144s21c1
Sequence:CCGGGATGAGGAGATGTTCTACAAACTCGAGTTTGTAGAACATCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146054.2-2799s21c1
Sequence:CCGGGCCTTTGTGTTACAATATGAACTCGAGTTCATATTGTAACACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146054.2-2360s21c1
Sequence:CCGGGCCTACCTTGATATGCCGTATCTCGAGATACGGCATATCAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146054
VALIDATED
FERMT2 MISSION shRNA shRNA Plasmid DNA
fermitin family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146054.1-380s1c1
Sequence:CCGGGAAGTATAAGAGCAAACAGATCTCGAGATCTGTTTGCTCTTATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-1014s1c1
Sequence:CCGGGCCTACCTTGATATGCCGTATCTCGAGATACGGCATATCAAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-798s1c1
Sequence:CCGGGATGAGGAGATGTTCTACAAACTCGAGTTTGTAGAACATCTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-1453s1c1
Sequence:CCGGGCCTTTGTGTTACAATATGAACTCGAGTTCATATTGTAACACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146054.2-1726s21c1
Sequence:CCGGGAAGTATAAGAGCAAACAGATCTCGAGATCTGTTTGCTCTTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146054.2-2144s21c1
Sequence:CCGGGATGAGGAGATGTTCTACAAACTCGAGTTTGTAGAACATCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146054.2-2799s21c1
Sequence:CCGGGCCTTTGTGTTACAATATGAACTCGAGTTCATATTGTAACACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146054.2-2360s21c1
Sequence:CCGGGCCTACCTTGATATGCCGTATCTCGAGATACGGCATATCAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146054
VALIDATED
FERMT2 MISSION shRNA Lentiviral Transduction Particles
fermitin family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146054.1-380s1c1
Sequence:CCGGGAAGTATAAGAGCAAACAGATCTCGAGATCTGTTTGCTCTTATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-1014s1c1
Sequence:CCGGGCCTACCTTGATATGCCGTATCTCGAGATACGGCATATCAAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-798s1c1
Sequence:CCGGGATGAGGAGATGTTCTACAAACTCGAGTTTGTAGAACATCTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146054.1-1453s1c1
Sequence:CCGGGCCTTTGTGTTACAATATGAACTCGAGTTCATATTGTAACACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146054.2-1726s21c1
Sequence:CCGGGAAGTATAAGAGCAAACAGATCTCGAGATCTGTTTGCTCTTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146054.2-2144s21c1
Sequence:CCGGGATGAGGAGATGTTCTACAAACTCGAGTTTGTAGAACATCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146054.2-2799s21c1
Sequence:CCGGGCCTTTGTGTTACAATATGAACTCGAGTTCATATTGTAACACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146054.2-2360s21c1
Sequence:CCGGGCCTACCTTGATATGCCGTATCTCGAGATACGGCATATCAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006832
VALIDATED
FERMT2 MISSION shRNA Bacterial Glycerol Stock
fermitin family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006832.1-1619s1c1
Sequence:CCGGCGACTGATATAACTCCTGAATCTCGAGATTCAGGAGTTATATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006832.1-1522s1c1
Sequence:CCGGGCGGACAGTTCTTACAACTTACTCGAGTAAGTTGTAAGAACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006832.1-2246s1c1
Sequence:CCGGGCCTTACCAGACCAGTTAATACTCGAGTATTAACTGGTCTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006832.1-2453s1c1
Sequence:CCGGCCAGGGCTTAACCTATATGAACTCGAGTTCATATAGGTTAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006832.1-485s1c1
Sequence:CCGGCCGAAGAACTTTCTCTCTTAACTCGAGTTAAGAGAGAAAGTTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1715s21c1
Sequence:CCGGAGCAGATCACGACTGATATAACTCGAGTTATATCAGTCGTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1822s21c1
Sequence:CCGGGTAGCTCAGATGAGTCTAATTCTCGAGAATTAGACTCATCTGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1627s21c1
Sequence:CCGGGCGGACAGTTCTTACAACTTACTCGAGTAAGTTGTAAGAACTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006832.2-2351s21c1
Sequence:CCGGGCCTTACCAGACCAGTTAATACTCGAGTATTAACTGGTCTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1980s21c1
Sequence:CCGGCAGCACTGGAGATGCAATTAACTCGAGTTAATTGCATCTCCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006832
VALIDATED
FERMT2 MISSION shRNA shRNA Plasmid DNA
fermitin family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006832.1-1619s1c1
Sequence:CCGGCGACTGATATAACTCCTGAATCTCGAGATTCAGGAGTTATATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006832.1-1522s1c1
Sequence:CCGGGCGGACAGTTCTTACAACTTACTCGAGTAAGTTGTAAGAACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006832.1-2246s1c1
Sequence:CCGGGCCTTACCAGACCAGTTAATACTCGAGTATTAACTGGTCTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006832.1-2453s1c1
Sequence:CCGGCCAGGGCTTAACCTATATGAACTCGAGTTCATATAGGTTAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006832.1-485s1c1
Sequence:CCGGCCGAAGAACTTTCTCTCTTAACTCGAGTTAAGAGAGAAAGTTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1715s21c1
Sequence:CCGGAGCAGATCACGACTGATATAACTCGAGTTATATCAGTCGTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1822s21c1
Sequence:CCGGGTAGCTCAGATGAGTCTAATTCTCGAGAATTAGACTCATCTGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1627s21c1
Sequence:CCGGGCGGACAGTTCTTACAACTTACTCGAGTAAGTTGTAAGAACTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006832.2-2351s21c1
Sequence:CCGGGCCTTACCAGACCAGTTAATACTCGAGTATTAACTGGTCTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1980s21c1
Sequence:CCGGCAGCACTGGAGATGCAATTAACTCGAGTTAATTGCATCTCCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006832
VALIDATED
FERMT2 MISSION shRNA Lentiviral Transduction Particles
fermitin family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006832.1-1619s1c1
Sequence:CCGGCGACTGATATAACTCCTGAATCTCGAGATTCAGGAGTTATATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006832.1-1522s1c1
Sequence:CCGGGCGGACAGTTCTTACAACTTACTCGAGTAAGTTGTAAGAACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006832.1-2246s1c1
Sequence:CCGGGCCTTACCAGACCAGTTAATACTCGAGTATTAACTGGTCTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006832.1-2453s1c1
Sequence:CCGGCCAGGGCTTAACCTATATGAACTCGAGTTCATATAGGTTAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006832.1-485s1c1
Sequence:CCGGCCGAAGAACTTTCTCTCTTAACTCGAGTTAAGAGAGAAAGTTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1715s21c1
Sequence:CCGGAGCAGATCACGACTGATATAACTCGAGTTATATCAGTCGTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1822s21c1
Sequence:CCGGGTAGCTCAGATGAGTCTAATTCTCGAGAATTAGACTCATCTGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1627s21c1
Sequence:CCGGGCGGACAGTTCTTACAACTTACTCGAGTAAGTTGTAAGAACTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006832.2-2351s21c1
Sequence:CCGGGCCTTACCAGACCAGTTAATACTCGAGTATTAACTGGTCTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006832.2-1980s21c1
Sequence:CCGGCAGCACTGGAGATGCAATTAACTCGAGTTAATTGCATCTCCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks