EMAIL THIS PAGE TO A FRIEND

FERMT3

fermitin family member 3

60 Gene Product Result for
Synonyms: KIND3 MIG-2 MIG2B UNC112C URP2 URP2SF
UniProtKB ID: Q86UX7, Q8IUA1, Q8N207, Q9BT48
Gene ID:
Human(83706) Summary: Kindlins are a small family of proteins that mediate protein-protein interactions involved in integrin activation and thereby have a role in cell adhesion, migration, differentiation, and proliferation. The protein encoded by this gene has a key role in the regulation of hemostasis and thrombosis. This protein may also help maintain the membrane skeleton of erythrocytes. Mutations in this gene cause the autosomal recessive leukocyte adhesion deficiency syndrome-III (LAD-III). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2010]
Mouse(108101) fermitin family homolog 3 (Drosophila)
Rat(309186) fermitin family member 3
domestic cat(101097347) fermitin family member 3
cow(525159) fermitin family member 3
Horse(100050011) fermitin family member 3
dog(483766) fermitin family member 3
naked mole-rat(101700927) fermitin family member 3
domestic guinea pig(100719497) fermitin family member 3
sheep(101115330) fermitin family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031471 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031471 Rosetta Predictions human pricing
NM_178443 Rosetta Predictions human pricing
NM_001127543 Rosetta Predictions rat pricing
NM_153795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058861 predicted 252
2 SASI_Hs01_00058864 predicted 1802
3 SASI_Hs01_00058865 predicted 1799
4 SASI_Hs01_00058866 predicted 1837
5 SASI_Hs01_00058867 predicted 816
6 SASI_Hs01_00058868 predicted 264
7 SASI_Hs01_00058869 predicted 271
8 SASI_Hs01_00058870 predicted 257
9 SASI_Hs02_00358896 predicted 1857
10 SASI_Hs02_00358897 predicted 1840
11 SASI_Hs01_00058862 predicted 861
12 SASI_Hs01_00058863 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180267 predicted 260
2 SASI_Hs01_00180269 predicted 1821
3 SASI_Hs01_00180270 predicted 1821
4 SASI_Hs01_00180271 predicted 1853
5 SASI_Hs01_00180272 predicted 825
6 SASI_Hs01_00180273 predicted 275
7 SASI_Hs01_00180274 predicted 278
8 SASI_Hs01_00180275 predicted 260
9 SASI_Hs02_00369673 predicted 1872
10 SASI_Hs01_00180276 predicted 1852
11 SASI_Hs01_00180268 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254183 predicted 850
2 SASI_Rn02_00254184 predicted 1798
3 SASI_Rn02_00254185 predicted 835
4 SASI_Rn02_00254186 predicted 1126
5 SASI_Rn02_00254187 predicted 2061
6 SASI_Rn02_00254188 predicted 1224
7 SASI_Rn02_00254189 predicted 1329
8 SASI_Rn02_00254190 predicted 295
9 SASI_Rn02_00254191 predicted 1885
10 SASI_Rn02_00254192 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051589 predicted 218
2 SASI_Mm01_00051590 predicted 1481
3 SASI_Mm01_00051591 predicted 1837
4 SASI_Mm01_00051592 predicted 1862
5 SASI_Mm01_00051593 predicted 908
6 SASI_Mm01_00051594 predicted 1295
7 SASI_Mm01_00051595 predicted 1404
8 SASI_Mm01_00051596 predicted 1797
9 SASI_Mm01_00051597 predicted 1951
10 SASI_Mm01_00051598 predicted 1320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153795
FERMT3 MISSION shRNA Bacterial Glycerol Stock
fermitin family member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-1094s21c1
Sequence:CCGGCCTGCAGTACCACATCAACAACTCGAGTTGTTGATGTGGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-954s21c1
Sequence:CCGGCGATTTAAGTACTACAGCTTTCTCGAGAAAGCTGTAGTACTTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-2034s21c1
Sequence:CCGGGAGTTCGATGAACACATCAATCTCGAGATTGATGTGTTCATCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-669s1c1
Sequence:CCGGGACCTGACAAAGGTTGTCTTACTCGAGTAAGACAACCTTTGTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-329s1c1
Sequence:CCGGCGTGGAGGAAATCAATCGCAACTCGAGTTGCGATTGATTTCCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-1208s1c1
Sequence:CCGGGCTGGATAGTCTCACTACCATCTCGAGATGGTAGTGAGACTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153795.1-2483s1c1
Sequence:CCGGGAGGAACCACAAATCCTGGTTCTCGAGAACCAGGATTTGTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153795.1-2413s1c1
Sequence:CCGGCGACCTCTATGTAGTCCCTAACTCGAGTTAGGGACTACATAGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153795
FERMT3 MISSION shRNA shRNA Plasmid DNA
fermitin family member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-1094s21c1
Sequence:CCGGCCTGCAGTACCACATCAACAACTCGAGTTGTTGATGTGGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-954s21c1
Sequence:CCGGCGATTTAAGTACTACAGCTTTCTCGAGAAAGCTGTAGTACTTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-2034s21c1
Sequence:CCGGGAGTTCGATGAACACATCAATCTCGAGATTGATGTGTTCATCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-669s1c1
Sequence:CCGGGACCTGACAAAGGTTGTCTTACTCGAGTAAGACAACCTTTGTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-329s1c1
Sequence:CCGGCGTGGAGGAAATCAATCGCAACTCGAGTTGCGATTGATTTCCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-1208s1c1
Sequence:CCGGGCTGGATAGTCTCACTACCATCTCGAGATGGTAGTGAGACTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153795.1-2483s1c1
Sequence:CCGGGAGGAACCACAAATCCTGGTTCTCGAGAACCAGGATTTGTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153795.1-2413s1c1
Sequence:CCGGCGACCTCTATGTAGTCCCTAACTCGAGTTAGGGACTACATAGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153795
FERMT3 MISSION shRNA Lentiviral Transduction Particles
fermitin family member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-1094s21c1
Sequence:CCGGCCTGCAGTACCACATCAACAACTCGAGTTGTTGATGTGGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-954s21c1
Sequence:CCGGCGATTTAAGTACTACAGCTTTCTCGAGAAAGCTGTAGTACTTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153795.2-2034s21c1
Sequence:CCGGGAGTTCGATGAACACATCAATCTCGAGATTGATGTGTTCATCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-669s1c1
Sequence:CCGGGACCTGACAAAGGTTGTCTTACTCGAGTAAGACAACCTTTGTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-329s1c1
Sequence:CCGGCGTGGAGGAAATCAATCGCAACTCGAGTTGCGATTGATTTCCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153795.1-1208s1c1
Sequence:CCGGGCTGGATAGTCTCACTACCATCTCGAGATGGTAGTGAGACTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153795.1-2483s1c1
Sequence:CCGGGAGGAACCACAAATCCTGGTTCTCGAGAACCAGGATTTGTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153795.1-2413s1c1
Sequence:CCGGCGACCTCTATGTAGTCCCTAACTCGAGTTAGGGACTACATAGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031471
FERMT3 MISSION shRNA Bacterial Glycerol Stock
fermitin family member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031471.5-1281s21c1
Sequence:CCGGGAGACCACACTGTCCTACTACCTCGAGGTAGTAGGACAGTGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031471.5-2020s21c1
Sequence:CCGGGCCGAATTGTACACGAGTATACTCGAGTATACTCGTGTACAATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-260s1c1
Sequence:CCGGGACTGGTCAGACCATGCTATTCTCGAGAATAGCATGGTCTGACCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-976s1c1
Sequence:CCGGCCTGCAGTACCACATCAACAACTCGAGTTGTTGATGTGGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-1144s1c1
Sequence:CCGGCAAGGACCATCTCCGAATCTTCTCGAGAAGATTCGGAGATGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-1338s1c1
Sequence:CCGGGCATTAAACTCCTAGTGCCCTCTCGAGAGGGCACTAGGAGTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-853s1c1
Sequence:CCGGCTTCTTCGATTTGGATCCCAACTCGAGTTGGGATCCAAATCGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031471
FERMT3 MISSION shRNA shRNA Plasmid DNA
fermitin family member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031471.5-1281s21c1
Sequence:CCGGGAGACCACACTGTCCTACTACCTCGAGGTAGTAGGACAGTGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031471.5-2020s21c1
Sequence:CCGGGCCGAATTGTACACGAGTATACTCGAGTATACTCGTGTACAATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-260s1c1
Sequence:CCGGGACTGGTCAGACCATGCTATTCTCGAGAATAGCATGGTCTGACCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-976s1c1
Sequence:CCGGCCTGCAGTACCACATCAACAACTCGAGTTGTTGATGTGGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-1144s1c1
Sequence:CCGGCAAGGACCATCTCCGAATCTTCTCGAGAAGATTCGGAGATGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-1338s1c1
Sequence:CCGGGCATTAAACTCCTAGTGCCCTCTCGAGAGGGCACTAGGAGTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-853s1c1
Sequence:CCGGCTTCTTCGATTTGGATCCCAACTCGAGTTGGGATCCAAATCGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031471
FERMT3 MISSION shRNA Lentiviral Transduction Particles
fermitin family member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031471.5-1281s21c1
Sequence:CCGGGAGACCACACTGTCCTACTACCTCGAGGTAGTAGGACAGTGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031471.5-2020s21c1
Sequence:CCGGGCCGAATTGTACACGAGTATACTCGAGTATACTCGTGTACAATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-260s1c1
Sequence:CCGGGACTGGTCAGACCATGCTATTCTCGAGAATAGCATGGTCTGACCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-976s1c1
Sequence:CCGGCCTGCAGTACCACATCAACAACTCGAGTTGTTGATGTGGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-1144s1c1
Sequence:CCGGCAAGGACCATCTCCGAATCTTCTCGAGAAGATTCGGAGATGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-1338s1c1
Sequence:CCGGGCATTAAACTCCTAGTGCCCTCTCGAGAGGGCACTAGGAGTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031471.4-853s1c1
Sequence:CCGGCTTCTTCGATTTGGATCCCAACTCGAGTTGGGATCCAAATCGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks