EMAIL THIS PAGE TO A FRIEND

FES

feline sarcoma oncogene

105 Gene Product Result for
Synonyms: FPS
Gene ID:
Human(2242) Summary: This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
Mouse(14159) feline sarcoma oncogene
Rat(361597) feline sarcoma oncogene
Zebrafish(566739) feline sarcoma oncogene
cow(507304) feline sarcoma oncogene
Horse(100146891) feline sarcoma oncogene
domestic cat(100329136) feline sarcoma oncogene
domestic cat(101100568) feline sarcoma oncogene
dog(609483) feline sarcoma oncogene
chicken(429374) feline sarcoma oncogene
domestic guinea pig(100733440) feline sarcoma oncogene
naked mole-rat(101718703) feline sarcoma oncogene
sheep(101107049) feline sarcoma oncogene
Domestic Rabbit(100338780) feline sarcoma oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002005 Rosetta Predictions human pricing
NM_001108488 Rosetta Predictions rat pricing
NM_010194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238996 predicted 2266
2 SASI_Hs01_00238997 predicted 1958
3 SASI_Hs01_00238998 predicted 535
4 SASI_Hs01_00238999 predicted 1632
5 SASI_Hs01_00239000 predicted 194
6 SASI_Hs01_00239001 predicted 2428
7 SASI_Hs01_00239002 predicted 1921
8 SASI_Hs01_00239003 predicted 978
9 SASI_Hs02_00333004 predicted 897
10 SASI_Hs01_00239004 predicted 1074
11 SASI_Hs01_00239005 predicted 2260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239139 predicted 258
2 SASI_Rn02_00239140 predicted 1632
3 SASI_Rn02_00239141 predicted 2324
4 SASI_Rn02_00239142 predicted 200
5 SASI_Rn02_00239143 predicted 1841
6 SASI_Rn02_00239144 predicted 530
7 SASI_Rn02_00239145 predicted 1653
8 SASI_Rn02_00239146 predicted 1241
9 SASI_Rn02_00239147 predicted 1848
10 SASI_Rn02_00239148 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318001 predicted 235
2 SASI_Mm01_00145395 predicted 1993
3 SASI_Mm01_00145396 predicted 1197
4 SASI_Mm01_00145397 predicted 2306
5 SASI_Mm01_00145398 predicted 2007
6 SASI_Mm01_00145399 predicted 1822
7 SASI_Mm02_00318002 predicted 2528
8 SASI_Mm02_00318003 predicted 1635
9 SASI_Mm01_00145400 predicted 2128
10 SASI_Mm01_00145401 predicted 1253
11 SASI_Mm01_00145402 predicted 1149
12 SASI_Mm01_00145403 predicted 1573
13 SASI_Mm01_00145404 predicted 1821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002005
VALIDATED
FES MISSION shRNA Bacterial Glycerol Stock
feline sarcoma oncogene
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-593s21c1
Sequence:GTACCGGACAAGGCTAAGGACAAGTATGCTCGAGCATACTTGTCCTTAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-1778s21c1
Sequence:GTACCGGTGGTGTTGGGTGAGCAGATTGCTCGAGCAATCTGCTCACCCAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-1978s21c1
Sequence:CCGGCAGAAGCAGCCCATCTACATCCTCGAGGATGTAGATGGGCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-2372s21c1
Sequence:CCGGATCAGCAGACACGGGAGTTTGCTCGAGCAAACTCCCGTGTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-1868s21c1
Sequence:CCGGCTGACCTCAAGGCCAAGTTTCCTCGAGGAAACTTGGCCTTGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-1338s21c1
Sequence:CCGGACCCACGCTGGAGATCCTTAACTCGAGTTAAGGATCTCCAGCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-572s21c1
Sequence:CCGGACAAGGCCAAGGACAAGTATGCTCGAGCATACTTGTCCTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-151s21c1
Sequence:CCGGCTACTGGAGGGCATGAGAAAGCTCGAGCTTTCTCATGCCCTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-776s21c1
Sequence:CCGGTGCAGGAATACCTGGAGATTACTCGAGTAATCTCCAGGTATTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1603s1c1
Sequence:CCGGGATAACCTGTACCGACTGGAACTCGAGTTCCAGTCGGTACAGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1875s1c1
Sequence:CCGGCAAGGCCAAGTTTCTACAGGACTCGAGTCCTGTAGAAACTTGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1599s1c1
Sequence:CCGGCTTGGATAACCTGTACCGACTCTCGAGAGTCGGTACAGGTTATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-2152s1c1
Sequence:CCGGGAGAAGAATGTCCTGAAGATCCTCGAGGATCTTCAGGACATTCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1641s1c1
Sequence:CCGGCATTCCTTTGCTCATCGACCACTCGAGTGGTCGATGAGCAAAGGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2557s1c1
Sequence:CCGGCTTCTCAAGCTGGTGGCCTCTCTCGAGAGAGGCCACCAGCTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2602s1c1
Sequence:CCGGCGGCTCCAGCTCATATGCTGACTCGAGTCAGCATATGAGCTGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2610s1c1
Sequence:CCGGGCTCATATGCTGACAGCTCTTCTCGAGAAGAGCTGTCAGCATATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002005.2-573s1c1
Sequence:CCGGCAAGGCCAAGGACAAGTATGTCTCGAGACATACTTGTCCTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002005
VALIDATED
FES MISSION shRNA shRNA Plasmid DNA
feline sarcoma oncogene
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-593s21c1
Sequence:GTACCGGACAAGGCTAAGGACAAGTATGCTCGAGCATACTTGTCCTTAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-1778s21c1
Sequence:GTACCGGTGGTGTTGGGTGAGCAGATTGCTCGAGCAATCTGCTCACCCAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-1978s21c1
Sequence:CCGGCAGAAGCAGCCCATCTACATCCTCGAGGATGTAGATGGGCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-2372s21c1
Sequence:CCGGATCAGCAGACACGGGAGTTTGCTCGAGCAAACTCCCGTGTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-1868s21c1
Sequence:CCGGCTGACCTCAAGGCCAAGTTTCCTCGAGGAAACTTGGCCTTGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-1338s21c1
Sequence:CCGGACCCACGCTGGAGATCCTTAACTCGAGTTAAGGATCTCCAGCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-572s21c1
Sequence:CCGGACAAGGCCAAGGACAAGTATGCTCGAGCATACTTGTCCTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-151s21c1
Sequence:CCGGCTACTGGAGGGCATGAGAAAGCTCGAGCTTTCTCATGCCCTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-776s21c1
Sequence:CCGGTGCAGGAATACCTGGAGATTACTCGAGTAATCTCCAGGTATTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1603s1c1
Sequence:CCGGGATAACCTGTACCGACTGGAACTCGAGTTCCAGTCGGTACAGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1875s1c1
Sequence:CCGGCAAGGCCAAGTTTCTACAGGACTCGAGTCCTGTAGAAACTTGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1599s1c1
Sequence:CCGGCTTGGATAACCTGTACCGACTCTCGAGAGTCGGTACAGGTTATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-2152s1c1
Sequence:CCGGGAGAAGAATGTCCTGAAGATCCTCGAGGATCTTCAGGACATTCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1641s1c1
Sequence:CCGGCATTCCTTTGCTCATCGACCACTCGAGTGGTCGATGAGCAAAGGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2557s1c1
Sequence:CCGGCTTCTCAAGCTGGTGGCCTCTCTCGAGAGAGGCCACCAGCTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2602s1c1
Sequence:CCGGCGGCTCCAGCTCATATGCTGACTCGAGTCAGCATATGAGCTGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2610s1c1
Sequence:CCGGGCTCATATGCTGACAGCTCTTCTCGAGAAGAGCTGTCAGCATATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002005.2-573s1c1
Sequence:CCGGCAAGGCCAAGGACAAGTATGTCTCGAGACATACTTGTCCTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002005
VALIDATED
FES MISSION shRNA Lentiviral Transduction Particles
feline sarcoma oncogene
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-593s21c1
Sequence:GTACCGGACAAGGCTAAGGACAAGTATGCTCGAGCATACTTGTCCTTAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-1778s21c1
Sequence:GTACCGGTGGTGTTGGGTGAGCAGATTGCTCGAGCAATCTGCTCACCCAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-1978s21c1
Sequence:CCGGCAGAAGCAGCCCATCTACATCCTCGAGGATGTAGATGGGCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-2372s21c1
Sequence:CCGGATCAGCAGACACGGGAGTTTGCTCGAGCAAACTCCCGTGTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-1868s21c1
Sequence:CCGGCTGACCTCAAGGCCAAGTTTCCTCGAGGAAACTTGGCCTTGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-1338s21c1
Sequence:CCGGACCCACGCTGGAGATCCTTAACTCGAGTTAAGGATCTCCAGCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-572s21c1
Sequence:CCGGACAAGGCCAAGGACAAGTATGCTCGAGCATACTTGTCCTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.2-151s21c1
Sequence:CCGGCTACTGGAGGGCATGAGAAAGCTCGAGCTTTCTCATGCCCTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002005.3-776s21c1
Sequence:CCGGTGCAGGAATACCTGGAGATTACTCGAGTAATCTCCAGGTATTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1603s1c1
Sequence:CCGGGATAACCTGTACCGACTGGAACTCGAGTTCCAGTCGGTACAGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1875s1c1
Sequence:CCGGCAAGGCCAAGTTTCTACAGGACTCGAGTCCTGTAGAAACTTGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1599s1c1
Sequence:CCGGCTTGGATAACCTGTACCGACTCTCGAGAGTCGGTACAGGTTATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-2152s1c1
Sequence:CCGGGAGAAGAATGTCCTGAAGATCCTCGAGGATCTTCAGGACATTCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002005.x-1641s1c1
Sequence:CCGGCATTCCTTTGCTCATCGACCACTCGAGTGGTCGATGAGCAAAGGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2557s1c1
Sequence:CCGGCTTCTCAAGCTGGTGGCCTCTCTCGAGAGAGGCCACCAGCTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2602s1c1
Sequence:CCGGCGGCTCCAGCTCATATGCTGACTCGAGTCAGCATATGAGCTGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002005.2-2610s1c1
Sequence:CCGGGCTCATATGCTGACAGCTCTTCTCGAGAAGAGCTGTCAGCATATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002005.2-573s1c1
Sequence:CCGGCAAGGCCAAGGACAAGTATGTCTCGAGACATACTTGTCCTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010194
VALIDATED
FES MISSION shRNA Bacterial Glycerol Stock
feline sarcoma oncogene
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1828s21c1
Sequence:CCGGGGAACTTCGGAGAGGTGTTTACTCGAGTAAACACCTCTCCGAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-2602s21c1
Sequence:CCGGGCGTGTACCTCCTCAGCAGTTCTCGAGAACTGCTGAGGAGGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-1382s21c1
Sequence:CCGGACCCACACTGGAGATCCTTAACTCGAGTTAAGGATCTCCAGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-902s21c1
Sequence:CCGGCCTAGGCTTCCTGCGACAATACTCGAGTATTGTCGCAGGAAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-232s21c1
Sequence:CCGGTCAAGAGTGACCGGGAATATGCTCGAGCATATTCCCGGTCACTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-179s21c1
Sequence:CCGGGGAAGCTGAGCTGCGCTTATTCTCGAGAATAAGCGCAGCTCAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-2273s21c1
Sequence:CCGGCCTCAGACAAGTCCCTGTTAACTCGAGTTAACAGGGACTTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-2416s21c1
Sequence:CCGGATCAGCAGACACGGGAGTTTGCTCGAGCAAACTCCCGTGTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1631s21c1
Sequence:CCGGCATCATCCAGTCCTCAGATAACTCGAGTTATCTGAGGACTGGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1192s21c1
Sequence:CCGGAGATGCTGCAAGAGGCAATACCTCGAGGTATTGCCTCTTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-1317s1c1
Sequence:CCGGCCCACACTGGAGATCCTTAAACTCGAGTTTAAGGATCTCCAGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-1571s1c1
Sequence:CCGGCCAGTCCTTAGATAACCTGTACTCGAGTACAGGTTATCTAAGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010194.1-2462s1c1
Sequence:CCGGGAGACCTAGTTTCAGCATCATCTCGAGATGATGCTGAAACTAGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010194.1-1146s1c1
Sequence:CCGGGCAATACAAGGGTTGCAGATACTCGAGTATCTGCAACCCTTGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-183s1c1
Sequence:CCGGCGGGAATATGCAGGATTGCTTCTCGAGAAGCAATCCTGCATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010194
VALIDATED
FES MISSION shRNA shRNA Plasmid DNA
feline sarcoma oncogene
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1828s21c1
Sequence:CCGGGGAACTTCGGAGAGGTGTTTACTCGAGTAAACACCTCTCCGAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-2602s21c1
Sequence:CCGGGCGTGTACCTCCTCAGCAGTTCTCGAGAACTGCTGAGGAGGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-1382s21c1
Sequence:CCGGACCCACACTGGAGATCCTTAACTCGAGTTAAGGATCTCCAGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-902s21c1
Sequence:CCGGCCTAGGCTTCCTGCGACAATACTCGAGTATTGTCGCAGGAAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-232s21c1
Sequence:CCGGTCAAGAGTGACCGGGAATATGCTCGAGCATATTCCCGGTCACTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-179s21c1
Sequence:CCGGGGAAGCTGAGCTGCGCTTATTCTCGAGAATAAGCGCAGCTCAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-2273s21c1
Sequence:CCGGCCTCAGACAAGTCCCTGTTAACTCGAGTTAACAGGGACTTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-2416s21c1
Sequence:CCGGATCAGCAGACACGGGAGTTTGCTCGAGCAAACTCCCGTGTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1631s21c1
Sequence:CCGGCATCATCCAGTCCTCAGATAACTCGAGTTATCTGAGGACTGGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1192s21c1
Sequence:CCGGAGATGCTGCAAGAGGCAATACCTCGAGGTATTGCCTCTTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-1317s1c1
Sequence:CCGGCCCACACTGGAGATCCTTAAACTCGAGTTTAAGGATCTCCAGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-1571s1c1
Sequence:CCGGCCAGTCCTTAGATAACCTGTACTCGAGTACAGGTTATCTAAGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010194.1-2462s1c1
Sequence:CCGGGAGACCTAGTTTCAGCATCATCTCGAGATGATGCTGAAACTAGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010194.1-1146s1c1
Sequence:CCGGGCAATACAAGGGTTGCAGATACTCGAGTATCTGCAACCCTTGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-183s1c1
Sequence:CCGGCGGGAATATGCAGGATTGCTTCTCGAGAAGCAATCCTGCATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010194
VALIDATED
FES MISSION shRNA Lentiviral Transduction Particles
feline sarcoma oncogene
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1828s21c1
Sequence:CCGGGGAACTTCGGAGAGGTGTTTACTCGAGTAAACACCTCTCCGAAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-2602s21c1
Sequence:CCGGGCGTGTACCTCCTCAGCAGTTCTCGAGAACTGCTGAGGAGGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-1382s21c1
Sequence:CCGGACCCACACTGGAGATCCTTAACTCGAGTTAAGGATCTCCAGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-902s21c1
Sequence:CCGGCCTAGGCTTCCTGCGACAATACTCGAGTATTGTCGCAGGAAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-232s21c1
Sequence:CCGGTCAAGAGTGACCGGGAATATGCTCGAGCATATTCCCGGTCACTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010194.2-179s21c1
Sequence:CCGGGGAAGCTGAGCTGCGCTTATTCTCGAGAATAAGCGCAGCTCAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-2273s21c1
Sequence:CCGGCCTCAGACAAGTCCCTGTTAACTCGAGTTAACAGGGACTTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-2416s21c1
Sequence:CCGGATCAGCAGACACGGGAGTTTGCTCGAGCAAACTCCCGTGTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1631s21c1
Sequence:CCGGCATCATCCAGTCCTCAGATAACTCGAGTTATCTGAGGACTGGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010194.2-1192s21c1
Sequence:CCGGAGATGCTGCAAGAGGCAATACCTCGAGGTATTGCCTCTTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-1317s1c1
Sequence:CCGGCCCACACTGGAGATCCTTAAACTCGAGTTTAAGGATCTCCAGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-1571s1c1
Sequence:CCGGCCAGTCCTTAGATAACCTGTACTCGAGTACAGGTTATCTAAGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010194.1-2462s1c1
Sequence:CCGGGAGACCTAGTTTCAGCATCATCTCGAGATGATGCTGAAACTAGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010194.1-1146s1c1
Sequence:CCGGGCAATACAAGGGTTGCAGATACTCGAGTATCTGCAACCCTTGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010194.1-183s1c1
Sequence:CCGGCGGGAATATGCAGGATTGCTTCTCGAGAAGCAATCCTGCATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks