EMAIL THIS PAGE TO A FRIEND

FETUB

fetuin B

93 Gene Product Result for
Synonyms: 16G2 Gugu IRL685
Gene ID:
Human(26998) Summary: The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
Mouse(59083) fetuin beta
Rat(83928) fetuin B
cow(504615) fetuin B
dog(478665) fetuin B
chicken(395404) fetuin B
sheep(101113641) fetuin B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014375 Rosetta Predictions human pricing
NM_053348 Rosetta Predictions rat pricing
NM_001083904 Rosetta Predictions mouse pricing
NM_001083905 Rosetta Predictions mouse pricing
NM_021564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033388 predicted 795
2 SASI_Hs01_00033390 predicted 1378
3 SASI_Hs01_00033391 predicted 1014
4 SASI_Hs01_00033392 predicted 273
5 SASI_Hs02_00345532 predicted 1060
6 SASI_Hs01_00033393 predicted 1005
7 SASI_Hs01_00033394 predicted 787
8 SASI_Hs01_00033395 predicted 796
9 SASI_Hs02_00345533 predicted 899
10 SASI_Hs01_00033397 predicted 1387
11 SASI_Hs01_00033389 predicted 1112
12 SASI_Hs01_00033396 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032134 predicted 440
2 SASI_Rn02_00265806 predicted 986
3 SASI_Rn02_00265807 predicted 619
4 SASI_Rn01_00032136 predicted 290
5 SASI_Rn01_00032138 predicted 928
6 SASI_Rn01_00032139 predicted 507
7 SASI_Rn02_00265808 predicted 677
8 SASI_Rn01_00032140 predicted 447
9 SASI_Rn01_00032141 predicted 512
10 SASI_Rn02_00265809 predicted 945
11 SASI_Rn01_00032135 predicted 630
12 SASI_Rn01_00032137 predicted 721
13 SASI_Rn01_00032142 predicted 507
14 SASI_Rn01_00032143 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299931 predicted 785
2 SASI_Mm02_00299932 predicted 631
3 SASI_Mm02_00299933 predicted 732
4 SASI_Mm02_00299934 predicted 728
5 SASI_Mm02_00299935 predicted 803
6 SASI_Mm02_00299936 predicted 720
7 SASI_Mm02_00299937 predicted 925
8 SASI_Mm02_00299938 predicted 867
9 SASI_Mm02_00299939 predicted 650
10 SASI_Mm02_00299940 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299941 predicted 953
2 SASI_Mm02_00299942 predicted 801
3 SASI_Mm02_00299943 predicted 904
4 SASI_Mm02_00299944 predicted 898
5 SASI_Mm02_00299945 predicted 979
6 SASI_Mm02_00299946 predicted 889
7 SASI_Mm02_00299947 predicted 1098
8 SASI_Mm02_00299948 predicted 1038
9 SASI_Mm02_00299949 predicted 816
10 SASI_Mm02_00299950 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326347 predicted 1024
2 SASI_Mm02_00326348 predicted 869
3 SASI_Mm01_00069005 predicted 971
4 SASI_Mm02_00326349 predicted 962
5 SASI_Mm02_00326350 predicted 1039
6 SASI_Mm02_00326351 predicted 950
7 SASI_Mm02_00326352 predicted 1159
8 SASI_Mm01_00069009 predicted 1107
9 SASI_Mm01_00069011 predicted 887
10 SASI_Mm01_00069013 predicted 980
11 SASI_Mm01_00069004 predicted 543
12 SASI_Mm01_00069006 predicted 389
13 SASI_Mm01_00069007 predicted 595
14 SASI_Mm01_00069008 predicted 386
15 SASI_Mm01_00069010 predicted 608
16 SASI_Mm01_00069012 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021564
VALIDATED
FETUB MISSION shRNA Bacterial Glycerol Stock
fetuin B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-581s1c1
Sequence:CCGGCCAAGAAGAGTTCTCTACTTACTCGAGTAAGTAGAGAACTCTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-804s1c1
Sequence:CCGGGCCCTGCTTACTATGTGGAATCTCGAGATTCCACATAGTAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-602s1c1
Sequence:CCGGCCTGCTTATAACTGTACACTTCTCGAGAAGTGTACAGTTATAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-944s1c1
Sequence:CCGGCCTCTGATCCAACCCGTAGAACTCGAGTTCTACGGGTTGGATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-379s1c1
Sequence:CCGGTGGCTATATGTTGAGCCTTAACTCGAGTTAAGGCTCAACATATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-883s21c1
Sequence:CCGGGCCCTGCTTACTATGTGGAATCTCGAGATTCCACATAGTAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-660s21c1
Sequence:CCGGCCAAGAAGAGTTCTCTACTTACTCGAGTAAGTAGAGAACTCTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-1023s21c1
Sequence:CCGGCCTCTGATCCAACCCGTAGAACTCGAGTTCTACGGGTTGGATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-458s21c1
Sequence:CCGGTGGCTATATGTTGAGCCTTAACTCGAGTTAAGGCTCAACATATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021564
VALIDATED
FETUB MISSION shRNA shRNA Plasmid DNA
fetuin B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-581s1c1
Sequence:CCGGCCAAGAAGAGTTCTCTACTTACTCGAGTAAGTAGAGAACTCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-804s1c1
Sequence:CCGGGCCCTGCTTACTATGTGGAATCTCGAGATTCCACATAGTAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-602s1c1
Sequence:CCGGCCTGCTTATAACTGTACACTTCTCGAGAAGTGTACAGTTATAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-944s1c1
Sequence:CCGGCCTCTGATCCAACCCGTAGAACTCGAGTTCTACGGGTTGGATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-379s1c1
Sequence:CCGGTGGCTATATGTTGAGCCTTAACTCGAGTTAAGGCTCAACATATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-883s21c1
Sequence:CCGGGCCCTGCTTACTATGTGGAATCTCGAGATTCCACATAGTAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-660s21c1
Sequence:CCGGCCAAGAAGAGTTCTCTACTTACTCGAGTAAGTAGAGAACTCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-1023s21c1
Sequence:CCGGCCTCTGATCCAACCCGTAGAACTCGAGTTCTACGGGTTGGATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-458s21c1
Sequence:CCGGTGGCTATATGTTGAGCCTTAACTCGAGTTAAGGCTCAACATATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021564
VALIDATED
FETUB MISSION shRNA Lentiviral Transduction Particles
fetuin B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-581s1c1
Sequence:CCGGCCAAGAAGAGTTCTCTACTTACTCGAGTAAGTAGAGAACTCTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-804s1c1
Sequence:CCGGGCCCTGCTTACTATGTGGAATCTCGAGATTCCACATAGTAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-602s1c1
Sequence:CCGGCCTGCTTATAACTGTACACTTCTCGAGAAGTGTACAGTTATAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-944s1c1
Sequence:CCGGCCTCTGATCCAACCCGTAGAACTCGAGTTCTACGGGTTGGATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021564.1-379s1c1
Sequence:CCGGTGGCTATATGTTGAGCCTTAACTCGAGTTAAGGCTCAACATATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-883s21c1
Sequence:CCGGGCCCTGCTTACTATGTGGAATCTCGAGATTCCACATAGTAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-660s21c1
Sequence:CCGGCCAAGAAGAGTTCTCTACTTACTCGAGTAAGTAGAGAACTCTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-1023s21c1
Sequence:CCGGCCTCTGATCCAACCCGTAGAACTCGAGTTCTACGGGTTGGATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021564.2-458s21c1
Sequence:CCGGTGGCTATATGTTGAGCCTTAACTCGAGTTAAGGCTCAACATATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014375
FETUB MISSION shRNA Bacterial Glycerol Stock
fetuin B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-477s1c1
Sequence:CCGGCCAAGTAGAGTTCTCTATTTACTCGAGTAAATAGAGAACTCTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-998s1c1
Sequence:CCGGGCCAAGAGGATCTGTCCAATACTCGAGTATTGGACAGATCCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-1103s1c1
Sequence:CCGGCCAGGGAGAAACCCTGGATATCTCGAGATATCCAGGGTTTCTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-811s1c1
Sequence:CCGGGCAAAGGTTCTCTGACTCGAACTCGAGTTCGAGTCAGAGAACCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-707s1c1
Sequence:CCGGCCCTTCTTACTTCGTGGAATACTCGAGTATTCCACGAAGTAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-239s21c1
Sequence:CCGGCTTTGCCCTGCGGGATATTAACTCGAGTTAATATCCCGCAGGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-431s21c1
Sequence:CCGGTGAATCAGTTTATGGTCAATGCTCGAGCATTGACCATAAACTGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-614s21c1
Sequence:CCGGCACCGAGTCTCTTGCGAAATACTCGAGTATTTCGCAAGAGACTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014375
FETUB MISSION shRNA shRNA Plasmid DNA
fetuin B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-477s1c1
Sequence:CCGGCCAAGTAGAGTTCTCTATTTACTCGAGTAAATAGAGAACTCTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-998s1c1
Sequence:CCGGGCCAAGAGGATCTGTCCAATACTCGAGTATTGGACAGATCCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-1103s1c1
Sequence:CCGGCCAGGGAGAAACCCTGGATATCTCGAGATATCCAGGGTTTCTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-811s1c1
Sequence:CCGGGCAAAGGTTCTCTGACTCGAACTCGAGTTCGAGTCAGAGAACCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-707s1c1
Sequence:CCGGCCCTTCTTACTTCGTGGAATACTCGAGTATTCCACGAAGTAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-239s21c1
Sequence:CCGGCTTTGCCCTGCGGGATATTAACTCGAGTTAATATCCCGCAGGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-431s21c1
Sequence:CCGGTGAATCAGTTTATGGTCAATGCTCGAGCATTGACCATAAACTGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-614s21c1
Sequence:CCGGCACCGAGTCTCTTGCGAAATACTCGAGTATTTCGCAAGAGACTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014375
FETUB MISSION shRNA Lentiviral Transduction Particles
fetuin B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-477s1c1
Sequence:CCGGCCAAGTAGAGTTCTCTATTTACTCGAGTAAATAGAGAACTCTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-998s1c1
Sequence:CCGGGCCAAGAGGATCTGTCCAATACTCGAGTATTGGACAGATCCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-1103s1c1
Sequence:CCGGCCAGGGAGAAACCCTGGATATCTCGAGATATCCAGGGTTTCTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-811s1c1
Sequence:CCGGGCAAAGGTTCTCTGACTCGAACTCGAGTTCGAGTCAGAGAACCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014375.1-707s1c1
Sequence:CCGGCCCTTCTTACTTCGTGGAATACTCGAGTATTCCACGAAGTAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-239s21c1
Sequence:CCGGCTTTGCCCTGCGGGATATTAACTCGAGTTAATATCCCGCAGGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-431s21c1
Sequence:CCGGTGAATCAGTTTATGGTCAATGCTCGAGCATTGACCATAAACTGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014375.2-614s21c1
Sequence:CCGGCACCGAGTCTCTTGCGAAATACTCGAGTATTTCGCAAGAGACTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)