EMAIL THIS PAGE TO A FRIEND

FEV

FEV (ETS oncogene family)

47 Gene Product Result for
Synonyms: HSRNAFEV PET-1
UniProtKB ID: Q99581
Gene ID:
Human(54738) Summary: This gene belongs to the ETS transcription factor family. ETS family members have a highly conserved 85-amino acid ETS domain that binds purine-rich DNA sequences. The alanine-rich C-terminus of this gene indicates that it may act as a transcription repressor. This gene is exclusively expressed in neurons of the central serotonin (5-HT) system, a system implicated in the pathogeny of such psychiatric diseases as depression, anxiety, and eating disorders. In some types of Ewing tumors, this gene is fused to the Ewing sarcoma (EWS) gene following chromosome translocations. [provided by RefSeq, Jul 2008]
Mouse(260298) FEV (ETS oncogene family)
Rat(246271) FEV (ETS oncogene family)
domestic guinea pig(100723616) FEV (ETS oncogene family)
naked mole-rat(101698585) FEV (ETS oncogene family)
sheep(101113391) FEV (ETS oncogene family)
Zebrafish(791175) FEV (ETS oncogene family)
cow(524933) FEV (ETS oncogene family)
dog(488530) FEV (ETS oncogene family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017521 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017521 Rosetta Predictions human pricing
NM_144753 Rosetta Predictions rat pricing
NM_153111 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122958 predicted 1453
2 SASI_Hs01_00122959 predicted 1441
3 SASI_Hs01_00122960 predicted 1459
4 SASI_Hs01_00122961 predicted 1456
5 SASI_Hs01_00122962 predicted 1511
6 SASI_Hs01_00122963 predicted 1442
7 SASI_Hs01_00122964 predicted 1510
8 SASI_Hs01_00122965 predicted 1517
9 SASI_Hs01_00122966 predicted 1509
10 SASI_Hs01_00122967 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087792 predicted 849
2 SASI_Rn02_00268638 predicted 390
3 SASI_Rn01_00087794 predicted 935
4 SASI_Rn01_00087795 predicted 924
5 SASI_Rn02_00268639 predicted 381
6 SASI_Rn01_00087796 predicted 934
7 SASI_Rn01_00087797 predicted 940
8 SASI_Rn02_00268640 predicted 389
9 SASI_Rn02_00268641 predicted 382
10 SASI_Rn02_00268642 predicted 382
11 SASI_Rn01_00087793 predicted 1171
12 SASI_Rn01_00087798 predicted 1153
13 SASI_Rn01_00087799 predicted 702
14 SASI_Rn01_00087800 predicted 1296
15 SASI_Rn01_00087801 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159876 predicted 1011
2 SASI_Mm01_00159877 predicted 1129
3 SASI_Mm01_00159878 predicted 1134
4 SASI_Mm01_00159879 predicted 1040
5 SASI_Mm01_00159880 predicted 1075
6 SASI_Mm01_00159881 predicted 1047
7 SASI_Mm02_00342970 predicted 1177
8 SASI_Mm01_00159882 predicted 1008
9 SASI_Mm01_00159883 predicted 1042
10 SASI_Mm01_00159884 predicted 1136
11 SASI_Mm01_00159875 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017521
FEV MISSION shRNA Bacterial Glycerol Stock
FEV (ETS oncogene family)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017521.2-1638s21c1
Sequence:CCGGTCAATATCACTACTCTTTAACCTCGAGGTTAAAGAGTAGTGATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017521.2-1395s21c1
Sequence:CCGGCGTCCTCTAATCCAGAGTTTACTCGAGTAAACTCTGGATTAGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017521.2-701s21c1
Sequence:CCGGTTCAGAAAGGCAGCGGACAGACTCGAGTCTGTCCGCTGCCTTTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-650s1c1
Sequence:CCGGCGGTCTCTTCAAGGACGGGAACTCGAGTTCCCGTCCTTGAAGAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-611s1c1
Sequence:CCGGCCTGCTGATCAACATGTACCTCTCGAGAGGTACATGTTGATCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-899s1c1
Sequence:CCGGGCGCTACTACTACGACAAGAACTCGAGTTCTTGTCGTAGTAGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-863s1c1
Sequence:CCGGGCCCAACATGAACTACGACAACTCGAGTTGTCGTAGTTCATGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-1105s1c1
Sequence:CCGGGCCTCTCCAAACTCAACCTCACTCGAGTGAGGTTGAGTTTGGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017521
FEV MISSION shRNA shRNA Plasmid DNA
FEV (ETS oncogene family)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017521.2-1638s21c1
Sequence:CCGGTCAATATCACTACTCTTTAACCTCGAGGTTAAAGAGTAGTGATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017521.2-1395s21c1
Sequence:CCGGCGTCCTCTAATCCAGAGTTTACTCGAGTAAACTCTGGATTAGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017521.2-701s21c1
Sequence:CCGGTTCAGAAAGGCAGCGGACAGACTCGAGTCTGTCCGCTGCCTTTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-650s1c1
Sequence:CCGGCGGTCTCTTCAAGGACGGGAACTCGAGTTCCCGTCCTTGAAGAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-611s1c1
Sequence:CCGGCCTGCTGATCAACATGTACCTCTCGAGAGGTACATGTTGATCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-899s1c1
Sequence:CCGGGCGCTACTACTACGACAAGAACTCGAGTTCTTGTCGTAGTAGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-863s1c1
Sequence:CCGGGCCCAACATGAACTACGACAACTCGAGTTGTCGTAGTTCATGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-1105s1c1
Sequence:CCGGGCCTCTCCAAACTCAACCTCACTCGAGTGAGGTTGAGTTTGGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017521
FEV MISSION shRNA Lentiviral Transduction Particles
FEV (ETS oncogene family)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017521.2-1638s21c1
Sequence:CCGGTCAATATCACTACTCTTTAACCTCGAGGTTAAAGAGTAGTGATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017521.2-1395s21c1
Sequence:CCGGCGTCCTCTAATCCAGAGTTTACTCGAGTAAACTCTGGATTAGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017521.2-701s21c1
Sequence:CCGGTTCAGAAAGGCAGCGGACAGACTCGAGTCTGTCCGCTGCCTTTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-650s1c1
Sequence:CCGGCGGTCTCTTCAAGGACGGGAACTCGAGTTCCCGTCCTTGAAGAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-611s1c1
Sequence:CCGGCCTGCTGATCAACATGTACCTCTCGAGAGGTACATGTTGATCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-899s1c1
Sequence:CCGGGCGCTACTACTACGACAAGAACTCGAGTTCTTGTCGTAGTAGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-863s1c1
Sequence:CCGGGCCCAACATGAACTACGACAACTCGAGTTGTCGTAGTTCATGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017521.1-1105s1c1
Sequence:CCGGGCCTCTCCAAACTCAACCTCACTCGAGTGAGGTTGAGTTTGGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153111
FEV MISSION shRNA Bacterial Glycerol Stock
FEV (ETS oncogene family)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153111.1-1014s1c1
Sequence:CCGGCGACGTTCCTTTAACACAGATCTCGAGATCTGTGTTAAAGGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-732s1c1
Sequence:CCGGCCTATCCAAACTCAACTTGATCTCGAGATCAAGTTGAGTTTGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-474s1c1
Sequence:CCGGCGAGCGCAAGAGCAAGCCTAACTCGAGTTAGGCTTGCTCTTGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-244s1c1
Sequence:CCGGATCAACATGTACCTGCCAGATCTCGAGATCTGGCAGGTACATGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-573s1c1
Sequence:CCGGCTACGCCTACCGCTTTGACTTCTCGAGAAGTCAAAGCGGTAGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153111
FEV MISSION shRNA shRNA Plasmid DNA
FEV (ETS oncogene family)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153111.1-1014s1c1
Sequence:CCGGCGACGTTCCTTTAACACAGATCTCGAGATCTGTGTTAAAGGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-732s1c1
Sequence:CCGGCCTATCCAAACTCAACTTGATCTCGAGATCAAGTTGAGTTTGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-474s1c1
Sequence:CCGGCGAGCGCAAGAGCAAGCCTAACTCGAGTTAGGCTTGCTCTTGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-244s1c1
Sequence:CCGGATCAACATGTACCTGCCAGATCTCGAGATCTGGCAGGTACATGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-573s1c1
Sequence:CCGGCTACGCCTACCGCTTTGACTTCTCGAGAAGTCAAAGCGGTAGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153111
FEV MISSION shRNA Lentiviral Transduction Particles
FEV (ETS oncogene family)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153111.1-1014s1c1
Sequence:CCGGCGACGTTCCTTTAACACAGATCTCGAGATCTGTGTTAAAGGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-732s1c1
Sequence:CCGGCCTATCCAAACTCAACTTGATCTCGAGATCAAGTTGAGTTTGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-474s1c1
Sequence:CCGGCGAGCGCAAGAGCAAGCCTAACTCGAGTTAGGCTTGCTCTTGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-244s1c1
Sequence:CCGGATCAACATGTACCTGCCAGATCTCGAGATCTGGCAGGTACATGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153111.1-573s1c1
Sequence:CCGGCTACGCCTACCGCTTTGACTTCTCGAGAAGTCAAAGCGGTAGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks