EMAIL THIS PAGE TO A FRIEND

FEZ1

fasciculation and elongation protein zeta 1 (zygin I)

71 Gene Product Result for
UniProtKB ID: Q99689, O00679, O00728, Q6IBI7
Gene ID:
Human(9638) Summary: This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Mouse(235180) fasciculation and elongation protein zeta 1 (zygin I)
Rat(81730) fasciculation and elongation protein zeta 1 (zygin I)
Zebrafish(406705) fasciculation and elongation protein zeta 1 (zygin I)
cow(511751) fasciculation and elongation protein zeta 1 (zygin I)
Horse(100049011) fasciculation and elongation protein zeta 1 (zygin I)
domestic cat(101082594) fasciculation and elongation protein zeta 1 (zygin I)
dog(612764) fasciculation and elongation protein zeta 1 (zygin I)
chicken(425587) fasciculation and elongation protein zeta 1 (zygin I)
sheep(101110461) fasciculation and elongation protein zeta 1 (zygin I)
Domestic Rabbit(100354333) fasciculation and elongation protein zeta 1 (zygin I)
naked mole-rat(101698518) fasciculation and elongation protein zeta 1 (zygin I)
domestic guinea pig(100721075) fasciculation and elongation protein zeta 1 (zygin I)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005103 Rosetta Predictions human pricing
NM_022549 Rosetta Predictions human pricing
NM_031066 Rosetta Predictions rat pricing
NM_183171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158564 predicted 309
2 SASI_Hs02_00338988 predicted 1177
3 SASI_Hs01_00158565 predicted 1253
4 SASI_Hs01_00158566 predicted 1063
5 SASI_Hs01_00158567 predicted 952
6 SASI_Hs01_00158570 predicted 1276
7 SASI_Hs01_00158571 predicted 1079
8 SASI_Hs01_00158572 predicted 641
9 SASI_Hs01_00158573 predicted 1418
10 SASI_Hs02_00338989 predicted 777
11 SASI_Hs01_00158568 predicted 340
12 SASI_Hs01_00158569 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079804 predicted 639
2 SASI_Hs01_00079805 predicted 312
3 SASI_Hs01_00079806 predicted 763
4 SASI_Hs01_00079807 predicted 904
5 SASI_Hs01_00079808 predicted 923
6 SASI_Hs01_00079809 predicted 704
7 SASI_Hs01_00079810 predicted 809
8 SASI_Hs01_00079812 predicted 827
9 SASI_Hs01_00079813 predicted 804
10 SASI_Hs02_00355825 predicted 298
11 SASI_Hs01_00079811 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067691 predicted 1240
2 SASI_Rn01_00067692 predicted 1395
3 SASI_Rn01_00067693 predicted 815
4 SASI_Rn01_00067695 predicted 1380
5 SASI_Rn01_00067696 predicted 1425
6 SASI_Rn02_00264308 predicted 752
7 SASI_Rn01_00067697 predicted 1404
8 SASI_Rn01_00067698 predicted 1288
9 SASI_Rn02_00264309 predicted 579
10 SASI_Rn01_00067699 predicted 353
11 SASI_Rn01_00067694 predicted 948
12 SASI_Rn01_00067700 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350261 predicted 845
2 SASI_Mm01_00184752 predicted 968
3 SASI_Mm01_00184755 predicted 444
4 SASI_Mm02_00350262 predicted 815
5 SASI_Mm02_00350263 predicted 201
6 SASI_Mm02_00350264 predicted 449
7 SASI_Mm02_00350265 predicted 511
8 SASI_Mm02_00350266 predicted 413
9 SASI_Mm02_00350267 predicted 692
10 SASI_Mm02_00350268 predicted 237
11 SASI_Mm01_00184751 predicted 682
12 SASI_Mm01_00184753 predicted 1401
13 SASI_Mm01_00184754 predicted 1421
14 SASI_Mm01_00184756 predicted 1199
15 SASI_Mm01_00184757 predicted 1379
16 SASI_Mm01_00184758 predicted 1358
17 SASI_Mm01_00184759 predicted 320
18 SASI_Mm01_00184760 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183171
VALIDATED
FEZ1 MISSION shRNA Bacterial Glycerol Stock
fasciculation and elongation protein zeta 1 (zygin I)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183171.1-331s1c1
Sequence:CCGGGAGGACCTCGTGAATGAATTTCTCGAGAAATTCATTCACGAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183171.1-1254s1c1
Sequence:CCGGCTTCGCCATGAAGGAGGATAACTCGAGTTATCCTCCTTCATGGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183171.1-523s1c1
Sequence:CCGGCCAAACATTGAAGCTCTGAATCTCGAGATTCAGAGCTTCAATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183171.1-339s1c1
Sequence:CCGGCGTGAATGAATTTGATGAGAACTCGAGTTCTCATCAAATTCATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183171.1-1422s1c1
Sequence:CCGGGCGTGTATTTAAACGTGTATACTCGAGTATACACGTTTAAATACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183171
VALIDATED
FEZ1 MISSION shRNA shRNA Plasmid DNA
fasciculation and elongation protein zeta 1 (zygin I)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183171.1-331s1c1
Sequence:CCGGGAGGACCTCGTGAATGAATTTCTCGAGAAATTCATTCACGAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183171.1-1254s1c1
Sequence:CCGGCTTCGCCATGAAGGAGGATAACTCGAGTTATCCTCCTTCATGGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183171.1-523s1c1
Sequence:CCGGCCAAACATTGAAGCTCTGAATCTCGAGATTCAGAGCTTCAATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183171.1-339s1c1
Sequence:CCGGCGTGAATGAATTTGATGAGAACTCGAGTTCTCATCAAATTCATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183171.1-1422s1c1
Sequence:CCGGGCGTGTATTTAAACGTGTATACTCGAGTATACACGTTTAAATACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183171
VALIDATED
FEZ1 MISSION shRNA Lentiviral Transduction Particles
fasciculation and elongation protein zeta 1 (zygin I)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183171.1-331s1c1
Sequence:CCGGGAGGACCTCGTGAATGAATTTCTCGAGAAATTCATTCACGAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183171.1-1254s1c1
Sequence:CCGGCTTCGCCATGAAGGAGGATAACTCGAGTTATCCTCCTTCATGGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183171.1-523s1c1
Sequence:CCGGCCAAACATTGAAGCTCTGAATCTCGAGATTCAGAGCTTCAATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183171.1-339s1c1
Sequence:CCGGCGTGAATGAATTTGATGAGAACTCGAGTTCTCATCAAATTCATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183171.1-1422s1c1
Sequence:CCGGGCGTGTATTTAAACGTGTATACTCGAGTATACACGTTTAAATACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005103
VALIDATED
FEZ1 MISSION shRNA Bacterial Glycerol Stock
fasciculation and elongation protein zeta 1 (zygin I)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-232s1c1
Sequence:CCGGCCCAGTGTTTCTATGGTTCATCTCGAGATGAACCATAGAAACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-522s1c1
Sequence:CCGGCCAAACATCGAGGCTCTGAATCTCGAGATTCAGAGCCTCGATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-359s1c1
Sequence:CCGGGCTCAATGTCTGCTTTCGGAACTCGAGTTCCGAAAGCAGACATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-956s1c1
Sequence:CCGGCTCCTTTATCACGGTGCTTATCTCGAGATAAGCACCGTGATAAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-1283s1c1
Sequence:CCGGGCCTACTTTGCTAACGGACTACTCGAGTAGTCCGTTAGCAAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-636s21c1
Sequence:CCGGCTCACAGCAGATCAGGTAATTCTCGAGAATTACCTGATCTGCTGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-324s21c1
Sequence:CCGGTCCATGGAGGACCTCGTAAATCTCGAGATTTACGAGGTCCTCCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-957s21c1
Sequence:CCGGTCCTTTATCACGGTGCTTATTCTCGAGAATAAGCACCGTGATAAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005103.3-1102s21c1
Sequence:CCGGTGGAAGGCATCTCCAACATTCCTCGAGGAATGTTGGAGATGCCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005103.3-1437s21c1
Sequence:CCGGTATAGCTTAACCTGGATTAAACTCGAGTTTAATCCAGGTTAAGCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005103
VALIDATED
FEZ1 MISSION shRNA shRNA Plasmid DNA
fasciculation and elongation protein zeta 1 (zygin I)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-232s1c1
Sequence:CCGGCCCAGTGTTTCTATGGTTCATCTCGAGATGAACCATAGAAACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-522s1c1
Sequence:CCGGCCAAACATCGAGGCTCTGAATCTCGAGATTCAGAGCCTCGATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-359s1c1
Sequence:CCGGGCTCAATGTCTGCTTTCGGAACTCGAGTTCCGAAAGCAGACATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-956s1c1
Sequence:CCGGCTCCTTTATCACGGTGCTTATCTCGAGATAAGCACCGTGATAAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-1283s1c1
Sequence:CCGGGCCTACTTTGCTAACGGACTACTCGAGTAGTCCGTTAGCAAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-636s21c1
Sequence:CCGGCTCACAGCAGATCAGGTAATTCTCGAGAATTACCTGATCTGCTGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-324s21c1
Sequence:CCGGTCCATGGAGGACCTCGTAAATCTCGAGATTTACGAGGTCCTCCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-957s21c1
Sequence:CCGGTCCTTTATCACGGTGCTTATTCTCGAGAATAAGCACCGTGATAAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005103.3-1102s21c1
Sequence:CCGGTGGAAGGCATCTCCAACATTCCTCGAGGAATGTTGGAGATGCCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005103.3-1437s21c1
Sequence:CCGGTATAGCTTAACCTGGATTAAACTCGAGTTTAATCCAGGTTAAGCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005103
VALIDATED
FEZ1 MISSION shRNA Lentiviral Transduction Particles
fasciculation and elongation protein zeta 1 (zygin I)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-232s1c1
Sequence:CCGGCCCAGTGTTTCTATGGTTCATCTCGAGATGAACCATAGAAACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-522s1c1
Sequence:CCGGCCAAACATCGAGGCTCTGAATCTCGAGATTCAGAGCCTCGATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-359s1c1
Sequence:CCGGGCTCAATGTCTGCTTTCGGAACTCGAGTTCCGAAAGCAGACATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-956s1c1
Sequence:CCGGCTCCTTTATCACGGTGCTTATCTCGAGATAAGCACCGTGATAAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005103.3-1283s1c1
Sequence:CCGGGCCTACTTTGCTAACGGACTACTCGAGTAGTCCGTTAGCAAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-636s21c1
Sequence:CCGGCTCACAGCAGATCAGGTAATTCTCGAGAATTACCTGATCTGCTGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-324s21c1
Sequence:CCGGTCCATGGAGGACCTCGTAAATCTCGAGATTTACGAGGTCCTCCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005103.3-957s21c1
Sequence:CCGGTCCTTTATCACGGTGCTTATTCTCGAGAATAAGCACCGTGATAAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005103.3-1102s21c1
Sequence:CCGGTGGAAGGCATCTCCAACATTCCTCGAGGAATGTTGGAGATGCCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005103.3-1437s21c1
Sequence:CCGGTATAGCTTAACCTGGATTAAACTCGAGTTTAATCCAGGTTAAGCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)