EMAIL THIS PAGE TO A FRIEND

FEZ2

fasciculation and elongation protein zeta 2 (zygin II)

146 Gene Product Result for
Synonyms: HUM3CL
UniProtKB ID: Q9UHY8, Q5EBN3, Q76LN0, Q99690
Gene ID:
Human(9637) Summary: This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Other orthologs include the rat gene that encodes zygin II, which can bind to synaptotagmin. [provided by RefSeq, Jul 2008]
Mouse(225020) fasciculation and elongation protein zeta 2 (zygin II)
Rat(94269) fasciculation and elongation protein zeta 2 (zygin II)
domestic guinea pig(100715811) fasciculation and elongation protein zeta 2 (zygin II)
naked mole-rat(101721661) fasciculation and elongation protein zeta 2 (zygin II)
sheep(101121927) fasciculation and elongation protein zeta 2 (zygin II)
chicken(421472) fasciculation and elongation protein zeta 2 (zygin II)
domestic cat(101083258) fasciculation and elongation protein zeta 2 (zygin II)
cow(783196) fasciculation and elongation protein zeta 2 (zygin II)
cow(100299092) fasciculation and elongation protein zeta 2 (zygin II)
dog(483031) fasciculation and elongation protein zeta 2 (zygin II)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042548 Rosetta Predictions human pricing
NM_005102 Rosetta Predictions human pricing
NM_053600 Rosetta Predictions rat pricing
NM_199448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310508 predicted 322
2 SASI_Hs02_00310509 predicted 463
3 SASI_Hs02_00310510 predicted 1351
4 SASI_Hs02_00310511 predicted 1297
5 SASI_Hs02_00310512 predicted 419
6 SASI_Hs02_00310513 predicted 1478
7 SASI_Hs02_00310514 predicted 426
8 SASI_Hs02_00310515 predicted 1283
9 SASI_Hs02_00310516 predicted 374
10 SASI_Hs02_00310517 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206544 predicted 327
2 SASI_Hs01_00206546 predicted 467
3 SASI_Hs01_00206547 predicted 1278
4 SASI_Hs01_00206548 predicted 1217
5 SASI_Hs01_00206550 predicted 421
6 SASI_Hs01_00206551 predicted 1396
7 SASI_Hs01_00206552 predicted 430
8 SASI_Hs01_00206553 predicted 1200
9 SASI_Hs02_00338986 predicted 366
10 SASI_Hs02_00338987 predicted 1245
11 SASI_Hs01_00206545 predicted 1289
12 SASI_Hs01_00206549 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076015 predicted 283
2 SASI_Rn01_00076016 predicted 332
3 SASI_Rn02_00266286 predicted 771
4 SASI_Rn02_00266287 predicted 434
5 SASI_Rn01_00076017 predicted 625
6 SASI_Rn01_00076018 predicted 492
7 SASI_Rn01_00076019 predicted 599
8 SASI_Rn01_00076021 predicted 864
9 SASI_Rn01_00076022 predicted 866
10 SASI_Rn01_00076024 predicted 436
11 SASI_Rn01_00076020 predicted 980
12 SASI_Rn01_00076023 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072613 predicted 1120
2 SASI_Mm01_00072614 predicted 1297
3 SASI_Mm01_00072615 predicted 331
4 SASI_Mm01_00072616 predicted 1184
5 SASI_Mm01_00072617 predicted 1331
6 SASI_Mm01_00072618 predicted 1197
7 SASI_Mm02_00351467 predicted 1188
8 SASI_Mm01_00072619 predicted 1072
9 SASI_Mm02_00351468 predicted 284
10 SASI_Mm02_00351469 predicted 445
11 SASI_Mm01_00072620 predicted 495
12 SASI_Mm01_00072621 predicted 1338
13 SASI_Mm01_00072622 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005102
VALIDATED
FEZ2 MISSION shRNA Bacterial Glycerol Stock
fasciculation and elongation protein zeta 2 (zygin II)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-1267s21c1
Sequence:CCGGTTATAGAACCAACGGAAATATCTCGAGATATTTCCGTTGGTTCTATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-476s21c1
Sequence:CCGGGCTGGATATGCACTCAATCATCTCGAGATGATTGAGTGCATATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-783s21c1
Sequence:CCGGCGAGATGAACTGGAGTTTGAACTCGAGTTCAAACTCCAGTTCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005102.2-632s21c1
Sequence:CCGGCCAGGAAATTCAAACTCTCAACTCGAGTTGAGAGTTTGAATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-531s1c1
Sequence:CCGGCCAGGAAATTCAAACTCTCAACTCGAGTTGAGAGTTTGAATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-893s1c1
Sequence:CCGGCGTCTGTTGAAGATCTTCAAACTCGAGTTTGAAGATCTTCAACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-375s1c1
Sequence:CCGGGCTGGATATGCACTCAATCATCTCGAGATGATTGAGTGCATATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-682s1c1
Sequence:CCGGCGAGATGAACTGGAGTTTGAACTCGAGTTCAAACTCCAGTTCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005102.1-843s1c1
Sequence:CCGGCGGCACATATTTGACTACAGTCTCGAGACTGTAGTCAAATATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005102
VALIDATED
FEZ2 MISSION shRNA shRNA Plasmid DNA
fasciculation and elongation protein zeta 2 (zygin II)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-1267s21c1
Sequence:CCGGTTATAGAACCAACGGAAATATCTCGAGATATTTCCGTTGGTTCTATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-476s21c1
Sequence:CCGGGCTGGATATGCACTCAATCATCTCGAGATGATTGAGTGCATATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-783s21c1
Sequence:CCGGCGAGATGAACTGGAGTTTGAACTCGAGTTCAAACTCCAGTTCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005102.2-632s21c1
Sequence:CCGGCCAGGAAATTCAAACTCTCAACTCGAGTTGAGAGTTTGAATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-531s1c1
Sequence:CCGGCCAGGAAATTCAAACTCTCAACTCGAGTTGAGAGTTTGAATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-893s1c1
Sequence:CCGGCGTCTGTTGAAGATCTTCAAACTCGAGTTTGAAGATCTTCAACAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-375s1c1
Sequence:CCGGGCTGGATATGCACTCAATCATCTCGAGATGATTGAGTGCATATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-682s1c1
Sequence:CCGGCGAGATGAACTGGAGTTTGAACTCGAGTTCAAACTCCAGTTCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005102.1-843s1c1
Sequence:CCGGCGGCACATATTTGACTACAGTCTCGAGACTGTAGTCAAATATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005102
VALIDATED
FEZ2 MISSION shRNA Lentiviral Transduction Particles
fasciculation and elongation protein zeta 2 (zygin II)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-1267s21c1
Sequence:CCGGTTATAGAACCAACGGAAATATCTCGAGATATTTCCGTTGGTTCTATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-476s21c1
Sequence:CCGGGCTGGATATGCACTCAATCATCTCGAGATGATTGAGTGCATATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005102.2-783s21c1
Sequence:CCGGCGAGATGAACTGGAGTTTGAACTCGAGTTCAAACTCCAGTTCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005102.2-632s21c1
Sequence:CCGGCCAGGAAATTCAAACTCTCAACTCGAGTTGAGAGTTTGAATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-531s1c1
Sequence:CCGGCCAGGAAATTCAAACTCTCAACTCGAGTTGAGAGTTTGAATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-893s1c1
Sequence:CCGGCGTCTGTTGAAGATCTTCAAACTCGAGTTTGAAGATCTTCAACAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-375s1c1
Sequence:CCGGGCTGGATATGCACTCAATCATCTCGAGATGATTGAGTGCATATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005102.1-682s1c1
Sequence:CCGGCGAGATGAACTGGAGTTTGAACTCGAGTTCAAACTCCAGTTCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005102.1-843s1c1
Sequence:CCGGCGGCACATATTTGACTACAGTCTCGAGACTGTAGTCAAATATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199448
VALIDATED
FEZ2 MISSION shRNA Bacterial Glycerol Stock
fasciculation and elongation protein zeta 2 (zygin II)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-590s21c1
Sequence:CCGGCCAGGAGATTCAGACTCTCAACTCGAGTTGAGAGTCTGAATCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-332s21c1
Sequence:CCGGCCATACAAGGACCTTGCATTTCTCGAGAAATGCAAGGTCCTTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-1020s21c1
Sequence:CCGGCCAAGCTTGTTAACCGACTATCTCGAGATAGTCGGTTAACAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-776s21c1
Sequence:CCGGCAGCTTCATTTCCGCTCTGATCTCGAGATCAGAGCGGAAATGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-332s1c1
Sequence:CCGGCCATACAAGGACCTTGCATTTCTCGAGAAATGCAAGGTCCTTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-284s1c1
Sequence:CCGGCCTGACAGATAACTATGGGAACTCGAGTTCCCATAGTTATCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-776s1c1
Sequence:CCGGCAGCTTCATTTCCGCTCTGATCTCGAGATCAGAGCGGAAATGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-1020s1c1
Sequence:CCGGCCAAGCTTGTTAACCGACTATCTCGAGATAGTCGGTTAACAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-590s1c1
Sequence:CCGGCCAGGAGATTCAGACTCTCAACTCGAGTTGAGAGTCTGAATCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199448
VALIDATED
FEZ2 MISSION shRNA shRNA Plasmid DNA
fasciculation and elongation protein zeta 2 (zygin II)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-590s21c1
Sequence:CCGGCCAGGAGATTCAGACTCTCAACTCGAGTTGAGAGTCTGAATCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-332s21c1
Sequence:CCGGCCATACAAGGACCTTGCATTTCTCGAGAAATGCAAGGTCCTTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-1020s21c1
Sequence:CCGGCCAAGCTTGTTAACCGACTATCTCGAGATAGTCGGTTAACAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-776s21c1
Sequence:CCGGCAGCTTCATTTCCGCTCTGATCTCGAGATCAGAGCGGAAATGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-332s1c1
Sequence:CCGGCCATACAAGGACCTTGCATTTCTCGAGAAATGCAAGGTCCTTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-284s1c1
Sequence:CCGGCCTGACAGATAACTATGGGAACTCGAGTTCCCATAGTTATCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-776s1c1
Sequence:CCGGCAGCTTCATTTCCGCTCTGATCTCGAGATCAGAGCGGAAATGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-1020s1c1
Sequence:CCGGCCAAGCTTGTTAACCGACTATCTCGAGATAGTCGGTTAACAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-590s1c1
Sequence:CCGGCCAGGAGATTCAGACTCTCAACTCGAGTTGAGAGTCTGAATCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199448
VALIDATED
FEZ2 MISSION shRNA Lentiviral Transduction Particles
fasciculation and elongation protein zeta 2 (zygin II)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-590s21c1
Sequence:CCGGCCAGGAGATTCAGACTCTCAACTCGAGTTGAGAGTCTGAATCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-332s21c1
Sequence:CCGGCCATACAAGGACCTTGCATTTCTCGAGAAATGCAAGGTCCTTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-1020s21c1
Sequence:CCGGCCAAGCTTGTTAACCGACTATCTCGAGATAGTCGGTTAACAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199448.2-776s21c1
Sequence:CCGGCAGCTTCATTTCCGCTCTGATCTCGAGATCAGAGCGGAAATGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-332s1c1
Sequence:CCGGCCATACAAGGACCTTGCATTTCTCGAGAAATGCAAGGTCCTTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-284s1c1
Sequence:CCGGCCTGACAGATAACTATGGGAACTCGAGTTCCCATAGTTATCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-776s1c1
Sequence:CCGGCAGCTTCATTTCCGCTCTGATCTCGAGATCAGAGCGGAAATGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-1020s1c1
Sequence:CCGGCCAAGCTTGTTAACCGACTATCTCGAGATAGTCGGTTAACAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199448.1-590s1c1
Sequence:CCGGCCAGGAGATTCAGACTCTCAACTCGAGTTGAGAGTCTGAATCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)