EMAIL THIS PAGE TO A FRIEND

FEZF1

FEZ family zinc finger 1

66 Gene Product Result for
Synonyms: FEZ ZNF312B
UniProtKB ID: A0PJY2, A0PJY3, A4D0W3, B4DUP9, B7ZM98
Gene ID:
Mouse(73191) Fez family zinc finger 1
Rat(500048) Fez family zinc finger 1
Zebrafish(558801) FEZ family zinc finger 1
chicken(100859279) FEZ family zinc finger 1
cow(511770) FEZ family zinc finger 1
Horse(100071453) FEZ family zinc finger 1
domestic cat(101094254) FEZ family zinc finger 1
sheep(101123206) FEZ family zinc finger 1
naked mole-rat(101725843) FEZ family zinc finger 1
domestic guinea pig(100722372) FEZ family zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141371 MISSION® esiRNA esiRNA human FEZF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024613 Rosetta Predictions human pricing
NM_001109224 Rosetta Predictions rat pricing
XM_133029 Rosetta Predictions mouse pricing
XM_912486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117558 predicted 1032
2 SASI_Hs01_00117560 predicted 731
3 SASI_Hs01_00117561 predicted 1097
4 SASI_Hs01_00117562 predicted 1056
5 SASI_Hs02_00307188 predicted 667
6 SASI_Hs02_00307189 predicted 889
7 SASI_Hs01_00117564 predicted 990
8 SASI_Hs01_00117565 predicted 947
9 SASI_Hs01_00117566 predicted 923
10 SASI_Hs01_00117567 predicted 751
11 SASI_Hs01_00117559 predicted 1140
12 SASI_Hs01_00117563 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246304 predicted 1069
2 SASI_Rn02_00246305 predicted 1327
3 SASI_Rn02_00246306 predicted 954
4 SASI_Rn02_00246307 predicted 658
5 SASI_Rn02_00246308 predicted 914
6 SASI_Rn02_00246309 predicted 1140
7 SASI_Rn02_00246310 predicted 1272
8 SASI_Rn02_00246311 predicted 646
9 SASI_Rn02_00246312 predicted 1679
10 SASI_Rn02_00246313 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424496 predicted 1034
2 SASI_Mm02_00424497 predicted 957
3 SASI_Mm02_00424498 predicted 956
4 SASI_Mm02_00424499 predicted 966
5 SASI_Mm02_00424500 predicted 959
6 SASI_Mm02_00424501 predicted 1030
7 SASI_Mm02_00424502 predicted 1027
8 SASI_Mm02_00424503 predicted 963
9 SASI_Mm02_00424504 predicted 956
10 SASI_Mm02_00424505 predicted 959
11 SASI_Mm01_00239929 predicted 1313
12 SASI_Mm01_00239930 predicted 1066
13 SASI_Mm01_00239931 predicted 1397
14 SASI_Mm01_00239932 predicted 1146
15 SASI_Mm01_00239933 predicted 1227
16 SASI_Mm01_00239934 predicted 1241
17 SASI_Mm01_00239935 predicted 1498
18 SASI_Mm01_00239936 predicted 1255
19 SASI_Mm01_00239937 predicted 1318
20 SASI_Mm01_00239938 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437121 predicted 1276
2 SASI_Mm02_00437122 predicted 1390
3 SASI_Mm02_00437123 predicted 1393
4 SASI_Mm02_00437124 predicted 1060
5 SASI_Mm02_00437125 predicted 1082
6 SASI_Mm02_00437126 predicted 1250
7 SASI_Mm02_00437127 predicted 1286
8 SASI_Mm02_00437128 predicted 1769
9 SASI_Mm02_00437129 predicted 1250
10 SASI_Mm02_00437130 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024613
FEZF1 MISSION shRNA Bacterial Glycerol Stock
FEZ family zinc finger 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1201s1c1
Sequence:CCGGGAGAAGCAGTTCAAGTGCAATCTCGAGATTGCACTTGAACTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1325s1c1
Sequence:CCGGGCAGGAACTTTGACCTCAAGACTCGAGTCTTGAGGTCAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-291s1c1
Sequence:CCGGCAAGCACTCTCTGCATCTCAACTCGAGTTGAGATGCAGAGAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-168s1c1
Sequence:CCGGCAACATGATGAGCACGTCCAACTCGAGTTGGACGTGCTCATCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-960s1c1
Sequence:CCGGCGTTTGCAAAGTGTGCGGAAACTCGAGTTTCCGCACACTTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1242s1c1
Sequence:CCGGCCAGGTTTACAACCTCACCTTCTCGAGAAGGTGAGGTTGTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1275s1c1
Sequence:CCGGCCACAACGACAAGAAGCCTTTCTCGAGAAAGGCTTCTTGTCGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1011s1c1
Sequence:CCGGGCACAAGATCATTCACACGCACTCGAGTGCGTGTGAATGATCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-705s1c1
Sequence:CCGGCGAAAGGAATAAACTGGTGGTCTCGAGACCACCAGTTTATTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1212s1c1
Sequence:CCGGCAAGTGCAATATCTGCAACAACTCGAGTTGTTGCAGATATTGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-695s1c1
Sequence:CCGGCGTATTTAGCCGAAAGGAATACTCGAGTATTCCTTTCGGCTAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024613
FEZF1 MISSION shRNA shRNA Plasmid DNA
FEZ family zinc finger 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1201s1c1
Sequence:CCGGGAGAAGCAGTTCAAGTGCAATCTCGAGATTGCACTTGAACTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1325s1c1
Sequence:CCGGGCAGGAACTTTGACCTCAAGACTCGAGTCTTGAGGTCAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-291s1c1
Sequence:CCGGCAAGCACTCTCTGCATCTCAACTCGAGTTGAGATGCAGAGAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-168s1c1
Sequence:CCGGCAACATGATGAGCACGTCCAACTCGAGTTGGACGTGCTCATCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-960s1c1
Sequence:CCGGCGTTTGCAAAGTGTGCGGAAACTCGAGTTTCCGCACACTTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1242s1c1
Sequence:CCGGCCAGGTTTACAACCTCACCTTCTCGAGAAGGTGAGGTTGTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1275s1c1
Sequence:CCGGCCACAACGACAAGAAGCCTTTCTCGAGAAAGGCTTCTTGTCGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1011s1c1
Sequence:CCGGGCACAAGATCATTCACACGCACTCGAGTGCGTGTGAATGATCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-705s1c1
Sequence:CCGGCGAAAGGAATAAACTGGTGGTCTCGAGACCACCAGTTTATTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1212s1c1
Sequence:CCGGCAAGTGCAATATCTGCAACAACTCGAGTTGTTGCAGATATTGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-695s1c1
Sequence:CCGGCGTATTTAGCCGAAAGGAATACTCGAGTATTCCTTTCGGCTAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024613
FEZF1 MISSION shRNA Lentiviral Transduction Particles
FEZ family zinc finger 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1201s1c1
Sequence:CCGGGAGAAGCAGTTCAAGTGCAATCTCGAGATTGCACTTGAACTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1325s1c1
Sequence:CCGGGCAGGAACTTTGACCTCAAGACTCGAGTCTTGAGGTCAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-291s1c1
Sequence:CCGGCAAGCACTCTCTGCATCTCAACTCGAGTTGAGATGCAGAGAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-168s1c1
Sequence:CCGGCAACATGATGAGCACGTCCAACTCGAGTTGGACGTGCTCATCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-960s1c1
Sequence:CCGGCGTTTGCAAAGTGTGCGGAAACTCGAGTTTCCGCACACTTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1242s1c1
Sequence:CCGGCCAGGTTTACAACCTCACCTTCTCGAGAAGGTGAGGTTGTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1275s1c1
Sequence:CCGGCCACAACGACAAGAAGCCTTTCTCGAGAAAGGCTTCTTGTCGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-1011s1c1
Sequence:CCGGGCACAAGATCATTCACACGCACTCGAGTGCGTGTGAATGATCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-705s1c1
Sequence:CCGGCGAAAGGAATAAACTGGTGGTCTCGAGACCACCAGTTTATTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024613.1-1212s1c1
Sequence:CCGGCAAGTGCAATATCTGCAACAACTCGAGTTGTTGCAGATATTGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024613.1-695s1c1
Sequence:CCGGCGTATTTAGCCGAAAGGAATACTCGAGTATTCCTTTCGGCTAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133029
FEZF1 MISSION shRNA Bacterial Glycerol Stock
FEZ family zinc finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_133029.5-2148s21c1
Sequence:CCGGATGCCTGCTGATCGTTTATAACTCGAGTTATAAACGATCAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-1263s21c1
Sequence:CCGGTAACAGAAGTTCCACGTTAAACTCGAGTTTAACGTGGAACTTCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-1089s21c1
Sequence:GTACCGGGGTCTTTAATGCGCACTATAACTCGAGTTATAGTGCGCATTAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-651s21c1
Sequence:CCGGCAACTGCGCGCTAAGTCTTAACTCGAGTTAAGACTTAGCGCGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-350s21c1
Sequence:CCGGACGTGATGAGCACATCTAAACCTCGAGGTTTAGATGTGCTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133029
FEZF1 MISSION shRNA shRNA Plasmid DNA
FEZ family zinc finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_133029.5-2148s21c1
Sequence:CCGGATGCCTGCTGATCGTTTATAACTCGAGTTATAAACGATCAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-1263s21c1
Sequence:CCGGTAACAGAAGTTCCACGTTAAACTCGAGTTTAACGTGGAACTTCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-1089s21c1
Sequence:GTACCGGGGTCTTTAATGCGCACTATAACTCGAGTTATAGTGCGCATTAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-651s21c1
Sequence:CCGGCAACTGCGCGCTAAGTCTTAACTCGAGTTAAGACTTAGCGCGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-350s21c1
Sequence:CCGGACGTGATGAGCACATCTAAACCTCGAGGTTTAGATGTGCTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133029
FEZF1 MISSION shRNA Lentiviral Transduction Particles
FEZ family zinc finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_133029.5-2148s21c1
Sequence:CCGGATGCCTGCTGATCGTTTATAACTCGAGTTATAAACGATCAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-1263s21c1
Sequence:CCGGTAACAGAAGTTCCACGTTAAACTCGAGTTTAACGTGGAACTTCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-1089s21c1
Sequence:GTACCGGGGTCTTTAATGCGCACTATAACTCGAGTTATAGTGCGCATTAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-651s21c1
Sequence:CCGGCAACTGCGCGCTAAGTCTTAACTCGAGTTAAGACTTAGCGCGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133029.5-350s21c1
Sequence:CCGGACGTGATGAGCACATCTAAACCTCGAGGTTTAGATGTGCTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks