EMAIL THIS PAGE TO A FRIEND

FEZF2

FEZ family zinc finger 2

66 Gene Product Result for
Synonyms: FEZ FEZL TOF ZFP312 ZNF312
UniProtKB ID: Q8TBJ5, A8K349, Q9BZ91, Q9NWB9
Gene ID:
Mouse(54713) Fez family zinc finger 2
Rat(305719) Fez family zinc finger 2
Zebrafish(60634) FEZ family zinc finger 2
chicken(416074) FEZ family zinc finger 2
cow(613683) FEZ family zinc finger 2
Horse(100050147) FEZ family zinc finger 2
domestic cat(101083662) FEZ family zinc finger 2
dog(476568) FEZ family zinc finger 2
domestic guinea pig(100713168) FEZ family zinc finger 2
naked mole-rat(101708905) FEZ family zinc finger 2
sheep(101107393) FEZ family zinc finger 2
Domestic Rabbit(100358877) FEZ family zinc finger 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305775 ANTI-FEZF2 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2108481 Anti-ZNF312 IgG fraction of antiserum canine, bovine, pig, horse, mouse, rabbit, human, rat, guinea pig
western blot pricing
AV33141 Anti-ZNF312 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, rabbit, rat, canine, horse, guinea pig, human, bovine
western blot pricing
AV39321 Anti-ZNF312 (AB2) antibody produced in rabbit IgG fraction of antiserum , rabbit, bovine, canine, guinea pig, rat, horse, human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018008 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028831 MISSION® esiRNA esiRNA human FEZF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018008 Rosetta Predictions human pricing
NM_001107251 Rosetta Predictions rat pricing
NM_080433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043500 predicted 1300
2 SASI_Hs01_00043501 predicted 1143
3 SASI_Hs01_00043502 predicted 1446
4 SASI_Hs01_00043503 predicted 1137
5 SASI_Hs02_00351088 predicted 1146
6 SASI_Hs01_00043505 predicted 1392
7 SASI_Hs01_00043506 predicted 1452
8 SASI_Hs01_00043507 predicted 1306
9 SASI_Hs01_00043508 predicted 911
10 SASI_Hs01_00043509 predicted 1282
11 SASI_Hs01_00043504 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226995 predicted 1233
2 SASI_Rn02_00226996 predicted 1230
3 SASI_Rn02_00226997 predicted 1436
4 SASI_Rn02_00226998 predicted 1536
5 SASI_Rn02_00226999 predicted 1271
6 SASI_Rn02_00227000 predicted 1704
7 SASI_Rn02_00227001 predicted 1571
8 SASI_Rn02_00227002 predicted 1707
9 SASI_Rn02_00227003 predicted 1557
10 SASI_Rn02_00227004 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039354 predicted 1229
2 SASI_Mm01_00039355 predicted 1224
3 SASI_Mm01_00039356 predicted 1436
4 SASI_Mm01_00039357 predicted 1269
5 SASI_Mm01_00039358 predicted 725
6 SASI_Mm01_00039359 predicted 1374
7 SASI_Mm01_00039360 predicted 525
8 SASI_Mm01_00039361 predicted 557
9 SASI_Mm01_00039362 predicted 1399
10 SASI_Mm01_00039363 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018008
FEZF2 MISSION shRNA Bacterial Glycerol Stock
FEZ family zinc finger 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018008.3-1446s21c1
Sequence:CCGGGCGGCGAGAAGCAGTACAAATCTCGAGATTTGTACTGCTTCTCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018008.3-1791s21c1
Sequence:CCGGTTTATCGAAACCAGCATATTTCTCGAGAAATATGCTGGTTTCGATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018008.3-1895s21c1
Sequence:CCGGAGTGCGCCGAAACGTATTTAACTCGAGTTAAATACGTTTCGGCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-377s1c1
Sequence:CCGGCGTCAAAGACACTGCTCAGTTCTCGAGAACTGAGCAGTGTCTTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-300s1c1
Sequence:CCGGCCAGGGCAAGAAACTGCTCAACTCGAGTTGAGCAGTTTCTTGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-1329s1c1
Sequence:CCGGCTACAACCTAACCTTCCATATCTCGAGATATGGAAGGTTAGGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-975s1c1
Sequence:CCGGCAAGGTGTTTAACGCTCACTACTCGAGTAGTGAGCGTTAAACACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018008
FEZF2 MISSION shRNA shRNA Plasmid DNA
FEZ family zinc finger 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018008.3-1446s21c1
Sequence:CCGGGCGGCGAGAAGCAGTACAAATCTCGAGATTTGTACTGCTTCTCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018008.3-1791s21c1
Sequence:CCGGTTTATCGAAACCAGCATATTTCTCGAGAAATATGCTGGTTTCGATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018008.3-1895s21c1
Sequence:CCGGAGTGCGCCGAAACGTATTTAACTCGAGTTAAATACGTTTCGGCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-377s1c1
Sequence:CCGGCGTCAAAGACACTGCTCAGTTCTCGAGAACTGAGCAGTGTCTTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-300s1c1
Sequence:CCGGCCAGGGCAAGAAACTGCTCAACTCGAGTTGAGCAGTTTCTTGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-1329s1c1
Sequence:CCGGCTACAACCTAACCTTCCATATCTCGAGATATGGAAGGTTAGGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-975s1c1
Sequence:CCGGCAAGGTGTTTAACGCTCACTACTCGAGTAGTGAGCGTTAAACACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018008
FEZF2 MISSION shRNA Lentiviral Transduction Particles
FEZ family zinc finger 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018008.3-1446s21c1
Sequence:CCGGGCGGCGAGAAGCAGTACAAATCTCGAGATTTGTACTGCTTCTCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018008.3-1791s21c1
Sequence:CCGGTTTATCGAAACCAGCATATTTCTCGAGAAATATGCTGGTTTCGATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018008.3-1895s21c1
Sequence:CCGGAGTGCGCCGAAACGTATTTAACTCGAGTTAAATACGTTTCGGCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-377s1c1
Sequence:CCGGCGTCAAAGACACTGCTCAGTTCTCGAGAACTGAGCAGTGTCTTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-300s1c1
Sequence:CCGGCCAGGGCAAGAAACTGCTCAACTCGAGTTGAGCAGTTTCTTGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-1329s1c1
Sequence:CCGGCTACAACCTAACCTTCCATATCTCGAGATATGGAAGGTTAGGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018008.2-975s1c1
Sequence:CCGGCAAGGTGTTTAACGCTCACTACTCGAGTAGTGAGCGTTAAACACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080433
FEZF2 MISSION shRNA Bacterial Glycerol Stock
FEZ family zinc finger 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080433.1-1885s1c1
Sequence:CCGGGTGCGCTGAAACATATTTAATCTCGAGATTAAATATGTTTCAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-557s1c1
Sequence:CCGGGCTGCTCAGTTACTCGGAGTTCTCGAGAACTCCGAGTAACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-779s1c1
Sequence:CCGGCGGCTCTCTCTACTACTTCAACTCGAGTTGAAGTAGTAGAGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-1448s1c1
Sequence:CCGGCAAATGCACTATCTGTAACAACTCGAGTTGTTACAGATAGTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-1132s1c1
Sequence:CCGGAGGTGTTCAATGCTCACTATACTCGAGTATAGTGAGCATTGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080433
FEZF2 MISSION shRNA shRNA Plasmid DNA
FEZ family zinc finger 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080433.1-1885s1c1
Sequence:CCGGGTGCGCTGAAACATATTTAATCTCGAGATTAAATATGTTTCAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-557s1c1
Sequence:CCGGGCTGCTCAGTTACTCGGAGTTCTCGAGAACTCCGAGTAACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-779s1c1
Sequence:CCGGCGGCTCTCTCTACTACTTCAACTCGAGTTGAAGTAGTAGAGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-1448s1c1
Sequence:CCGGCAAATGCACTATCTGTAACAACTCGAGTTGTTACAGATAGTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-1132s1c1
Sequence:CCGGAGGTGTTCAATGCTCACTATACTCGAGTATAGTGAGCATTGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080433
FEZF2 MISSION shRNA Lentiviral Transduction Particles
FEZ family zinc finger 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080433.1-1885s1c1
Sequence:CCGGGTGCGCTGAAACATATTTAATCTCGAGATTAAATATGTTTCAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-557s1c1
Sequence:CCGGGCTGCTCAGTTACTCGGAGTTCTCGAGAACTCCGAGTAACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-779s1c1
Sequence:CCGGCGGCTCTCTCTACTACTTCAACTCGAGTTGAAGTAGTAGAGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-1448s1c1
Sequence:CCGGCAAATGCACTATCTGTAACAACTCGAGTTGTTACAGATAGTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080433.1-1132s1c1
Sequence:CCGGAGGTGTTCAATGCTCACTATACTCGAGTATAGTGAGCATTGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks