EMAIL THIS PAGE TO A FRIEND

FFAR1

free fatty acid receptor 1

54 Gene Product Result for
Synonyms: FFA1R GPCR40 GPR40
UniProtKB ID: O14842, Q0VAS2, Q4VBL4
Gene ID:
Human(2864) Summary: This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for medium and long chain free fatty acids and may be involved in the metabolic regulation of insulin secretion. Polymorphisms in this gene may be associated with type 2 diabetes. [provided by RefSeq, Apr 2009]
Mouse(233081) free fatty acid receptor 1
Rat(266607) free fatty acid receptor 1
sheep(101103088) free fatty acid receptor 1
naked mole-rat(101697043) free fatty acid receptor 1
dog(612661) free fatty acid receptor 1
domestic cat(101101019) free fatty acid receptor 1
cow(618180) free fatty acid receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108661 Anti-FFAR1 affinity isolated antibody bovine, pig, pig, mouse, rat, human
western blot pricing
SAB2701950 Anti-FFAR1 (C-terminal) antibody produced in rabbit human
immunohistochemistry, western blot pricing
SAB2100811 Anti-FFAR1 antibody produced in rabbit affinity isolated antibody rat, mouse, canine, human, pig
western blot pricing
SAB4501280 Anti-FFAR1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB2500481 Anti-GPR40 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005303 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005303 Rosetta Predictions human pricing
NM_153304 Rosetta Predictions rat pricing
NM_194057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219188 predicted 459
2 SASI_Hs01_00219189 predicted 621
3 SASI_Hs01_00219190 predicted 247
4 SASI_Hs01_00219191 predicted 628
5 SASI_Hs01_00219192 predicted 343
6 SASI_Hs02_00339368 predicted 461
7 SASI_Hs01_00219193 predicted 625
8 SASI_Hs01_00219194 predicted 479
9 SASI_Hs01_00219195 predicted 290
10 SASI_Hs01_00219196 predicted 626
11 SASI_Hs01_00219197 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056248 predicted 238
2 SASI_Rn02_00268948 predicted 555
3 SASI_Rn01_00056250 predicted 463
4 SASI_Rn01_00056251 predicted 298
5 SASI_Rn01_00056252 predicted 570
6 SASI_Rn01_00056253 predicted 473
7 SASI_Rn01_00056254 predicted 546
8 SASI_Rn01_00056255 predicted 549
9 SASI_Rn01_00056257 predicted 379
10 SASI_Rn02_00268949 predicted 462
11 SASI_Rn01_00056249 predicted 463
12 SASI_Rn01_00056256 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102368 predicted 457
2 SASI_Mm01_00102369 predicted 439
3 SASI_Mm01_00102370 predicted 474
4 SASI_Mm01_00102371 predicted 573
5 SASI_Mm01_00102374 predicted 289
6 SASI_Mm01_00102375 predicted 638
7 SASI_Mm02_00350575 predicted 550
8 SASI_Mm01_00102376 predicted 566
9 SASI_Mm02_00350576 predicted 465
10 SASI_Mm02_00350577 predicted 382
11 SASI_Mm01_00102367 predicted 235
12 SASI_Mm01_00102372 predicted 566
13 SASI_Mm01_00102373 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194057
FFAR1 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-51s1c1
Sequence:CCGGGCTGGGCTTTCCATTGAACTTCTCGAGAAGTTCAATGGAAAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-28s1c1
Sequence:CCGGGCTCTCTATGTATCTGCCTTTCTCGAGAAAGGCAGATACATAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-714s1c1
Sequence:CCGGGCCCTATAATGCCTCCAATGTCTCGAGACATTGGAGGCATTATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-544s1c1
Sequence:CCGGGCCCGTCTCAGTTTCTCCATTCTCGAGAATGGAGAAACTGAGACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-739s1c1
Sequence:CCGGAGTTTCATAAACCCGGACCTACTCGAGTAGGTCCGGGTTTATGAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194057.2-98s21c1
Sequence:CCGGACGCTAAACTGCGACTCACTCCTCGAGGAGTGAGTCGCAGTTTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194057.2-476s21c1
Sequence:CCGGGCATCAACATACCCGTGAATGCTCGAGCATTCACGGGTATGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194057
FFAR1 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-51s1c1
Sequence:CCGGGCTGGGCTTTCCATTGAACTTCTCGAGAAGTTCAATGGAAAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-28s1c1
Sequence:CCGGGCTCTCTATGTATCTGCCTTTCTCGAGAAAGGCAGATACATAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-714s1c1
Sequence:CCGGGCCCTATAATGCCTCCAATGTCTCGAGACATTGGAGGCATTATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-544s1c1
Sequence:CCGGGCCCGTCTCAGTTTCTCCATTCTCGAGAATGGAGAAACTGAGACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-739s1c1
Sequence:CCGGAGTTTCATAAACCCGGACCTACTCGAGTAGGTCCGGGTTTATGAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194057.2-98s21c1
Sequence:CCGGACGCTAAACTGCGACTCACTCCTCGAGGAGTGAGTCGCAGTTTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194057.2-476s21c1
Sequence:CCGGGCATCAACATACCCGTGAATGCTCGAGCATTCACGGGTATGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194057
FFAR1 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-51s1c1
Sequence:CCGGGCTGGGCTTTCCATTGAACTTCTCGAGAAGTTCAATGGAAAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-28s1c1
Sequence:CCGGGCTCTCTATGTATCTGCCTTTCTCGAGAAAGGCAGATACATAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-714s1c1
Sequence:CCGGGCCCTATAATGCCTCCAATGTCTCGAGACATTGGAGGCATTATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-544s1c1
Sequence:CCGGGCCCGTCTCAGTTTCTCCATTCTCGAGAATGGAGAAACTGAGACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194057.1-739s1c1
Sequence:CCGGAGTTTCATAAACCCGGACCTACTCGAGTAGGTCCGGGTTTATGAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194057.2-98s21c1
Sequence:CCGGACGCTAAACTGCGACTCACTCCTCGAGGAGTGAGTCGCAGTTTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194057.2-476s21c1
Sequence:CCGGGCATCAACATACCCGTGAATGCTCGAGCATTCACGGGTATGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005303
VALIDATED
FFAR1 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-702s1c1
Sequence:CCGGGCTCTGCGTAGGACCCTACAACTCGAGTTGTAGGGTCCTACGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-253s1c1
Sequence:CCGGGCCCACTTCTTCCCACTCTATCTCGAGATAGAGTGGGAAGAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-459s1c1
Sequence:CCGGCAGCAACACCTCCCTGGGCATCTCGAGATGCCCAGGGAGGTGTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-123s1c1
Sequence:CCGGCCTGGTCTACGCCCTGAACCTCTCGAGAGGTTCAGGGCGTAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005303.1-723s1c1
Sequence:CCGGCGCCTCCAACGTGGCCAGCTTCTCGAGAAGCTGGCCACGTTGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-416s21c1
Sequence:CCGGTGTCACCTGGGTCTGGTCTTTCTCGAGAAAGACCAGACCCAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-472s21c1
Sequence:CCGGCAACACCTCCCTGGGCATCAACTCGAGTTGATGCCCAGGGAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-598s21c1
Sequence:CCGGCATCACAGCCTTCTGCTACGTCTCGAGACGTAGCAGAAGGCTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-264s21c1
Sequence:CCGGCCCACTTCTTCCCACTCTATGCTCGAGCATAGAGTGGGAAGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-563s21c1
Sequence:CCGGAGCCTCTCTCTCCTGCTCTTTCTCGAGAAAGAGCAGGAGAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-130s21c1
Sequence:CCGGTAGCCTGGTCTACGCCCTGAACTCGAGTTCAGGGCGTAGACCAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005303
VALIDATED
FFAR1 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-702s1c1
Sequence:CCGGGCTCTGCGTAGGACCCTACAACTCGAGTTGTAGGGTCCTACGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-253s1c1
Sequence:CCGGGCCCACTTCTTCCCACTCTATCTCGAGATAGAGTGGGAAGAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-459s1c1
Sequence:CCGGCAGCAACACCTCCCTGGGCATCTCGAGATGCCCAGGGAGGTGTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-123s1c1
Sequence:CCGGCCTGGTCTACGCCCTGAACCTCTCGAGAGGTTCAGGGCGTAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005303.1-723s1c1
Sequence:CCGGCGCCTCCAACGTGGCCAGCTTCTCGAGAAGCTGGCCACGTTGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-416s21c1
Sequence:CCGGTGTCACCTGGGTCTGGTCTTTCTCGAGAAAGACCAGACCCAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-472s21c1
Sequence:CCGGCAACACCTCCCTGGGCATCAACTCGAGTTGATGCCCAGGGAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-598s21c1
Sequence:CCGGCATCACAGCCTTCTGCTACGTCTCGAGACGTAGCAGAAGGCTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-264s21c1
Sequence:CCGGCCCACTTCTTCCCACTCTATGCTCGAGCATAGAGTGGGAAGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-563s21c1
Sequence:CCGGAGCCTCTCTCTCCTGCTCTTTCTCGAGAAAGAGCAGGAGAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-130s21c1
Sequence:CCGGTAGCCTGGTCTACGCCCTGAACTCGAGTTCAGGGCGTAGACCAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005303
VALIDATED
FFAR1 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-702s1c1
Sequence:CCGGGCTCTGCGTAGGACCCTACAACTCGAGTTGTAGGGTCCTACGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-253s1c1
Sequence:CCGGGCCCACTTCTTCCCACTCTATCTCGAGATAGAGTGGGAAGAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-459s1c1
Sequence:CCGGCAGCAACACCTCCCTGGGCATCTCGAGATGCCCAGGGAGGTGTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005303.1-123s1c1
Sequence:CCGGCCTGGTCTACGCCCTGAACCTCTCGAGAGGTTCAGGGCGTAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005303.1-723s1c1
Sequence:CCGGCGCCTCCAACGTGGCCAGCTTCTCGAGAAGCTGGCCACGTTGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-416s21c1
Sequence:CCGGTGTCACCTGGGTCTGGTCTTTCTCGAGAAAGACCAGACCCAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-472s21c1
Sequence:CCGGCAACACCTCCCTGGGCATCAACTCGAGTTGATGCCCAGGGAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-598s21c1
Sequence:CCGGCATCACAGCCTTCTGCTACGTCTCGAGACGTAGCAGAAGGCTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-264s21c1
Sequence:CCGGCCCACTTCTTCCCACTCTATGCTCGAGCATAGAGTGGGAAGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-563s21c1
Sequence:CCGGAGCCTCTCTCTCCTGCTCTTTCTCGAGAAAGAGCAGGAGAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005303.2-130s21c1
Sequence:CCGGTAGCCTGGTCTACGCCCTGAACTCGAGTTCAGGGCGTAGACCAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks