EMAIL THIS PAGE TO A FRIEND

FFAR2

free fatty acid receptor 2

55 Gene Product Result for
Synonyms: FFA2R GPR43
UniProtKB ID: O15552, B0M0J9, Q4VAZ3, Q4VAZ5, Q4VBL5
Gene ID:
Human(2867) Summary: This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for short chain free fatty acids and may be involved in the inflammatory response and in regulating lipid plasma levels. [provided by RefSeq, Apr 2009]
Mouse(233079) free fatty acid receptor 2
Rat(292794) free fatty acid receptor 2
cow(522431) free fatty acid receptor 2
dog(484580) free fatty acid receptor 2
domestic guinea pig(100727294) free fatty acid receptor 2
naked mole-rat(101715403) free fatty acid receptor 2
Goat(100861307) free fatty acid receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005306 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005306 Rosetta Predictions human pricing
NM_001005877 Rosetta Predictions rat pricing
NM_146187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104968 predicted 753
2 SASI_Hs01_00104969 predicted 392
3 SASI_Hs01_00104972 predicted 500
4 SASI_Hs02_00339372 predicted 763
5 SASI_Hs01_00104973 predicted 420
6 SASI_Hs01_00104974 predicted 205
7 SASI_Hs01_00104975 predicted 235
8 SASI_Hs01_00104976 predicted 490
9 SASI_Hs01_00104977 predicted 699
10 SASI_Hs02_00339373 predicted 438
11 SASI_Hs01_00104970 predicted 470
12 SASI_Hs01_00104971 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031616 predicted 582
2 SASI_Rn01_00031618 predicted 414
3 SASI_Rn01_00031619 predicted 420
4 SASI_Rn02_00198451 predicted 666
5 SASI_Rn02_00198452 predicted 575
6 SASI_Rn01_00031621 predicted 475
7 SASI_Rn01_00031622 predicted 254
8 SASI_Rn01_00031623 predicted 303
9 SASI_Rn01_00031624 predicted 592
10 SASI_Rn01_00031625 predicted 208
11 SASI_Rn01_00031617 predicted 773
12 SASI_Rn01_00031620 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067666 predicted 571
2 SASI_Mm01_00067667 predicted 1342
3 SASI_Mm01_00067669 predicted 536
4 SASI_Mm01_00067670 predicted 1968
5 SASI_Mm01_00067671 predicted 1927
6 SASI_Mm01_00067672 predicted 966
7 SASI_Mm01_00067673 predicted 689
8 SASI_Mm01_00067674 predicted 740
9 SASI_Mm01_00067675 predicted 1104
10 SASI_Mm02_00341884 predicted 1970
11 SASI_Mm01_00067668 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005306
FFAR2 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-492s21c1
Sequence:CCGGCTACGAGAACTTCACCGATAACTCGAGTTATCGGTGAAGTTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-465s21c1
Sequence:CCGGGGTCAGAAGTGGCAATGAAATCTCGAGATTTCATTGCCACTTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005306.2-1157s21c1
Sequence:CCGGACTGAATTGTCCTACTCAAAGCTCGAGCTTTGAGTAGGACAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-365s21c1
Sequence:CCGGGGCCTCTGTATGGAGTGATTGCTCGAGCAATCACTCCATACAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005306.2-1197s21c1
Sequence:CCGGACGAAGAAGTAGTTAGGTATACTCGAGTATACCTAACTACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-980s21c1
Sequence:CCGGTCACTACAGAGTAGCAGTTTCCTCGAGGAAACTGCTACTCTGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-426s21c1
Sequence:CCGGCATCGTGATCATCGTTCAATACTCGAGTATTGAACGATGATCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-491s1c1
Sequence:CCGGGCTACGAGAACTTCACCGATACTCGAGTATCGGTGAAGTTCTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-774s1c1
Sequence:CCGGCGTGGTGTTCAGTTCACTCAACTCGAGTTGAGTGAACTGAACACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-464s1c1
Sequence:CCGGAGGTCAGAAGTGGCAATGAAACTCGAGTTTCATTGCCACTTCTGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-27s1c1
Sequence:CCGGGATCCTCATGGCTTACATCATCTCGAGATGATGTAAGCCATGAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-684s1c1
Sequence:CCGGGCTCAATTTCCTGGTGTGCTTCTCGAGAAGCACACCAGGAAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005306
FFAR2 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-492s21c1
Sequence:CCGGCTACGAGAACTTCACCGATAACTCGAGTTATCGGTGAAGTTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-465s21c1
Sequence:CCGGGGTCAGAAGTGGCAATGAAATCTCGAGATTTCATTGCCACTTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005306.2-1157s21c1
Sequence:CCGGACTGAATTGTCCTACTCAAAGCTCGAGCTTTGAGTAGGACAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-365s21c1
Sequence:CCGGGGCCTCTGTATGGAGTGATTGCTCGAGCAATCACTCCATACAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005306.2-1197s21c1
Sequence:CCGGACGAAGAAGTAGTTAGGTATACTCGAGTATACCTAACTACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-980s21c1
Sequence:CCGGTCACTACAGAGTAGCAGTTTCCTCGAGGAAACTGCTACTCTGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-426s21c1
Sequence:CCGGCATCGTGATCATCGTTCAATACTCGAGTATTGAACGATGATCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-491s1c1
Sequence:CCGGGCTACGAGAACTTCACCGATACTCGAGTATCGGTGAAGTTCTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-774s1c1
Sequence:CCGGCGTGGTGTTCAGTTCACTCAACTCGAGTTGAGTGAACTGAACACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-464s1c1
Sequence:CCGGAGGTCAGAAGTGGCAATGAAACTCGAGTTTCATTGCCACTTCTGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-27s1c1
Sequence:CCGGGATCCTCATGGCTTACATCATCTCGAGATGATGTAAGCCATGAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-684s1c1
Sequence:CCGGGCTCAATTTCCTGGTGTGCTTCTCGAGAAGCACACCAGGAAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005306
FFAR2 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-492s21c1
Sequence:CCGGCTACGAGAACTTCACCGATAACTCGAGTTATCGGTGAAGTTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-465s21c1
Sequence:CCGGGGTCAGAAGTGGCAATGAAATCTCGAGATTTCATTGCCACTTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005306.2-1157s21c1
Sequence:CCGGACTGAATTGTCCTACTCAAAGCTCGAGCTTTGAGTAGGACAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-365s21c1
Sequence:CCGGGGCCTCTGTATGGAGTGATTGCTCGAGCAATCACTCCATACAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005306.2-1197s21c1
Sequence:CCGGACGAAGAAGTAGTTAGGTATACTCGAGTATACCTAACTACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-980s21c1
Sequence:CCGGTCACTACAGAGTAGCAGTTTCCTCGAGGAAACTGCTACTCTGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005306.2-426s21c1
Sequence:CCGGCATCGTGATCATCGTTCAATACTCGAGTATTGAACGATGATCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-491s1c1
Sequence:CCGGGCTACGAGAACTTCACCGATACTCGAGTATCGGTGAAGTTCTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-774s1c1
Sequence:CCGGCGTGGTGTTCAGTTCACTCAACTCGAGTTGAGTGAACTGAACACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-464s1c1
Sequence:CCGGAGGTCAGAAGTGGCAATGAAACTCGAGTTTCATTGCCACTTCTGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-27s1c1
Sequence:CCGGGATCCTCATGGCTTACATCATCTCGAGATGATGTAAGCCATGAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005306.1-684s1c1
Sequence:CCGGGCTCAATTTCCTGGTGTGCTTCTCGAGAAGCACACCAGGAAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146187
FFAR2 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1205s1c1
Sequence:CCGGGCTGTTGTGACGCTTCTTAATCTCGAGATTAAGAAGCGTCACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146187.2-1927s1c1
Sequence:CCGGGCTGGAAAGAAGCCAATGGAACTCGAGTTCCATTGGCTTCTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1015s1c1
Sequence:CCGGCCAAATAACCTGCTACGAGAACTCGAGTTCTCGTAGCAGGTTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1336s1c1
Sequence:CCGGCCTGGATCCATTATTGTTCTACTCGAGTAGAACAATAATGGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-898s1c1
Sequence:CCGGCCGGCCACTGTATGGAGTGATCTCGAGATCACTCCATACAGTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146187
FFAR2 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1205s1c1
Sequence:CCGGGCTGTTGTGACGCTTCTTAATCTCGAGATTAAGAAGCGTCACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146187.2-1927s1c1
Sequence:CCGGGCTGGAAAGAAGCCAATGGAACTCGAGTTCCATTGGCTTCTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1015s1c1
Sequence:CCGGCCAAATAACCTGCTACGAGAACTCGAGTTCTCGTAGCAGGTTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1336s1c1
Sequence:CCGGCCTGGATCCATTATTGTTCTACTCGAGTAGAACAATAATGGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-898s1c1
Sequence:CCGGCCGGCCACTGTATGGAGTGATCTCGAGATCACTCCATACAGTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146187
FFAR2 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1205s1c1
Sequence:CCGGGCTGTTGTGACGCTTCTTAATCTCGAGATTAAGAAGCGTCACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146187.2-1927s1c1
Sequence:CCGGGCTGGAAAGAAGCCAATGGAACTCGAGTTCCATTGGCTTCTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1015s1c1
Sequence:CCGGCCAAATAACCTGCTACGAGAACTCGAGTTCTCGTAGCAGGTTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-1336s1c1
Sequence:CCGGCCTGGATCCATTATTGTTCTACTCGAGTAGAACAATAATGGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146187.2-898s1c1
Sequence:CCGGCCGGCCACTGTATGGAGTGATCTCGAGATCACTCCATACAGTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks