EMAIL THIS PAGE TO A FRIEND

FFAR3

free fatty acid receptor 3

Synonyms: FFA3R GPR41
UniProtKB ID: O14843, B2RWM8, Q14CM7
Gene ID:
Mouse(233080) free fatty acid receptor 3
Rat(365228) free fatty acid receptor 3
Goat(100861306) free fatty acid receptor 3
naked mole-rat(101696682) free fatty acid receptor 3
cow(527517) free fatty acid receptor 3
domestic cat(101100772) free fatty acid receptor 3
dog(612659) free fatty acid receptor 3
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005304 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005304 Rosetta Predictions human pricing
NM_001108912 Rosetta Predictions rat pricing
NM_001033316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339369 predicted 1350
2 SASI_Hs01_00076319 predicted 320
3 SASI_Hs01_00076320 predicted 642
4 SASI_Hs01_00076321 predicted 498
5 SASI_Hs01_00076323 predicted 543
6 SASI_Hs01_00076324 predicted 346
7 SASI_Hs01_00076325 predicted 474
8 SASI_Hs01_00076327 predicted 1226
9 SASI_Hs01_00076328 predicted 645
10 SASI_Hs02_00339370 predicted 385
11 SASI_Hs01_00076322 predicted 256
12 SASI_Hs01_00076326 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243315 predicted 815
2 SASI_Rn02_00243316 predicted 731
3 SASI_Rn02_00243317 predicted 404
4 SASI_Rn02_00243318 predicted 447
5 SASI_Rn02_00243319 predicted 474
6 SASI_Rn02_00243320 predicted 476
7 SASI_Rn02_00243321 predicted 290
8 SASI_Rn02_00243322 predicted 850
9 SASI_Rn02_00243323 predicted 495
10 SASI_Rn02_00243324 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068694 predicted 393
2 SASI_Mm02_00288527 predicted 830
3 SASI_Mm01_00068695 predicted 773
4 SASI_Mm02_00288528 predicted 396
5 SASI_Mm01_00068697 predicted 1142
6 SASI_Mm01_00068698 predicted 435
7 SASI_Mm01_00068699 predicted 1121
8 SASI_Mm01_00068700 predicted 813
9 SASI_Mm01_00068701 predicted 964
10 SASI_Mm01_00068703 predicted 1048
11 SASI_Mm01_00068696 predicted 291
12 SASI_Mm01_00068702 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005304
FFAR3 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005304.2-1215s1c1
Sequence:CCGGGTAGACATCTAGCCTCCCTAACTCGAGTTAGGGAGGCTAGATGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-94s1c1
Sequence:CCGGCGGCAATCACTGGTTCGTCTTCTCGAGAAGACGAACCAGTGATTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-504s1c1
Sequence:CCGGGCGTGGTCTACGTCATAGAATCTCGAGATTCTATGACGTAGACCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-1031s1c1
Sequence:CCGGGCTGAAAGAAAGACCAGTGAACTCGAGTTCACTGGTCTTTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-800s1c1
Sequence:CCGGGTGGGCTATATCTGCGGTGAACTCGAGTTCACCGCAGATATAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-110s21c1
Sequence:CCGGGCAATCACTGGTTCGTCTTCTCTCGAGAGAAGACGAACCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005304.3-1246s21c1
Sequence:CCGGCTAAGGGTATGCGCGCTAAAGCTCGAGCTTTAGCGCGCATACCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-805s21c1
Sequence:CCGGTCCCATGTCGTGGGCTATATCCTCGAGGATATAGCCCACGACATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-516s21c1
Sequence:CCGGCAGCGTGGTCTACGTCATAGACTCGAGTCTATGACGTAGACCACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005304
FFAR3 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005304.2-1215s1c1
Sequence:CCGGGTAGACATCTAGCCTCCCTAACTCGAGTTAGGGAGGCTAGATGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-94s1c1
Sequence:CCGGCGGCAATCACTGGTTCGTCTTCTCGAGAAGACGAACCAGTGATTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-504s1c1
Sequence:CCGGGCGTGGTCTACGTCATAGAATCTCGAGATTCTATGACGTAGACCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-1031s1c1
Sequence:CCGGGCTGAAAGAAAGACCAGTGAACTCGAGTTCACTGGTCTTTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-800s1c1
Sequence:CCGGGTGGGCTATATCTGCGGTGAACTCGAGTTCACCGCAGATATAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-110s21c1
Sequence:CCGGGCAATCACTGGTTCGTCTTCTCTCGAGAGAAGACGAACCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005304.3-1246s21c1
Sequence:CCGGCTAAGGGTATGCGCGCTAAAGCTCGAGCTTTAGCGCGCATACCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-805s21c1
Sequence:CCGGTCCCATGTCGTGGGCTATATCCTCGAGGATATAGCCCACGACATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-516s21c1
Sequence:CCGGCAGCGTGGTCTACGTCATAGACTCGAGTCTATGACGTAGACCACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005304
FFAR3 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005304.2-1215s1c1
Sequence:CCGGGTAGACATCTAGCCTCCCTAACTCGAGTTAGGGAGGCTAGATGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-94s1c1
Sequence:CCGGCGGCAATCACTGGTTCGTCTTCTCGAGAAGACGAACCAGTGATTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-504s1c1
Sequence:CCGGGCGTGGTCTACGTCATAGAATCTCGAGATTCTATGACGTAGACCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-1031s1c1
Sequence:CCGGGCTGAAAGAAAGACCAGTGAACTCGAGTTCACTGGTCTTTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005304.2-800s1c1
Sequence:CCGGGTGGGCTATATCTGCGGTGAACTCGAGTTCACCGCAGATATAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-110s21c1
Sequence:CCGGGCAATCACTGGTTCGTCTTCTCTCGAGAGAAGACGAACCAGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005304.3-1246s21c1
Sequence:CCGGCTAAGGGTATGCGCGCTAAAGCTCGAGCTTTAGCGCGCATACCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-805s21c1
Sequence:CCGGTCCCATGTCGTGGGCTATATCCTCGAGGATATAGCCCACGACATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005304.3-516s21c1
Sequence:CCGGCAGCGTGGTCTACGTCATAGACTCGAGTCTATGACGTAGACCACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033316
FFAR3 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033316.2-1231s21c1
Sequence:CCGGTCCTTCCTATCCTCTCATAAACTCGAGTTTATGAGAGGATAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-482s21c1
Sequence:CCGGGCTCACTGTAGTGTGGTTTACCTCGAGGTAAACCACACTACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-842s21c1
Sequence:CCGGAGCACCCTCAACTCTTGTATCCTCGAGGATACAAGAGTTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-891s21c1
Sequence:CCGGCCAAGTTCCAAGCCGACTTTCCTCGAGGAAAGTCGGCTTGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-208s21c1
Sequence:CCGGTTTGCTAAACCTGACCATTTCCTCGAGGAAATGGTCAGGTTTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033316
FFAR3 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033316.2-1231s21c1
Sequence:CCGGTCCTTCCTATCCTCTCATAAACTCGAGTTTATGAGAGGATAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-482s21c1
Sequence:CCGGGCTCACTGTAGTGTGGTTTACCTCGAGGTAAACCACACTACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-842s21c1
Sequence:CCGGAGCACCCTCAACTCTTGTATCCTCGAGGATACAAGAGTTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-891s21c1
Sequence:CCGGCCAAGTTCCAAGCCGACTTTCCTCGAGGAAAGTCGGCTTGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-208s21c1
Sequence:CCGGTTTGCTAAACCTGACCATTTCCTCGAGGAAATGGTCAGGTTTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033316
FFAR3 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033316.2-1231s21c1
Sequence:CCGGTCCTTCCTATCCTCTCATAAACTCGAGTTTATGAGAGGATAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-482s21c1
Sequence:CCGGGCTCACTGTAGTGTGGTTTACCTCGAGGTAAACCACACTACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-842s21c1
Sequence:CCGGAGCACCCTCAACTCTTGTATCCTCGAGGATACAAGAGTTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-891s21c1
Sequence:CCGGCCAAGTTCCAAGCCGACTTTCCTCGAGGAAAGTCGGCTTGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033316.2-208s21c1
Sequence:CCGGTTTGCTAAACCTGACCATTTCCTCGAGGAAATGGTCAGGTTTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks