EMAIL THIS PAGE TO A FRIEND

FFAR4

free fatty acid receptor 4

49 Gene Product Result for
Synonyms: BMIQ10 GPR120 GPR129 GT01 O3FAR1 PGR4
UniProtKB ID: Q5NUL3, Q495H1, Q5VY25, Q5VY26, Q7Z605, Q86SM7
Gene ID:
Human(338557) Summary: This gene encodes a G protein-coupled receptor (GPR) which belongs to the rhodopsin family of GPRs. The encoded protein functions as a receptor for free fatty acids, including omega-3, and participates in suppressing anti-inflammatory responses and insulin sensitizing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(107221) free fatty acid receptor 4
Rat(294075) free fatty acid receptor 4
sheep(101105201) free fatty acid receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181745 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006751 MISSION® esiRNA esiRNA targeting mouse Gpr120 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181745 Rosetta Predictions human pricing
NM_001047088 Rosetta Predictions rat pricing
NM_181748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207171 predicted 908
2 SASI_Hs01_00207172 predicted 209
3 SASI_Hs01_00207173 predicted 779
4 SASI_Hs01_00207174 predicted 713
5 SASI_Hs01_00207175 predicted 646
6 SASI_Hs01_00207176 predicted 611
7 SASI_Hs01_00207177 predicted 758
8 SASI_Hs01_00207178 predicted 662
9 SASI_Hs01_00207179 predicted 808
10 SASI_Hs01_00207180 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205814 predicted 1145
2 SASI_Rn02_00205815 predicted 609
3 SASI_Rn02_00205816 predicted 1085
4 SASI_Rn02_00205817 predicted 847
5 SASI_Rn02_00205818 predicted 262
6 SASI_Rn02_00205819 predicted 1111
7 SASI_Rn02_00205820 predicted 757
8 SASI_Rn02_00205821 predicted 1096
9 SASI_Rn02_00205822 predicted 698
10 SASI_Rn02_00205823 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041344 predicted 1095
2 SASI_Mm01_00041345 predicted 1110
3 SASI_Mm01_00041347 predicted 1096
4 SASI_Mm01_00041348 predicted 764
5 SASI_Mm02_00349905 predicted 384
6 SASI_Mm01_00041351 predicted 1161
7 SASI_Mm01_00041352 predicted 970
8 SASI_Mm02_00349906 predicted 1169
9 SASI_Mm01_00041353 predicted 926
10 SASI_Mm02_00349907 predicted 609
11 SASI_Mm01_00041346 predicted 857
12 SASI_Mm01_00041349 predicted 1093
13 SASI_Mm01_00041350 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181745
FFAR4 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-1017s21c1
Sequence:CCGGTGGGTGGTGGCCTTCACATTTCTCGAGAAATGTGAAGGCCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-717s21c1
Sequence:CCGGCTGGTCATTGTGATCAGTTACCTCGAGGTAACTGATCACAATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-617s21c1
Sequence:CCGGCGACCAGGAAATTTCGATTTGCTCGAGCAAATCGAAATTTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-557s1c1
Sequence:CCGGCCGACCAGGAAATTTCGATTTCTCGAGAAATCGAAATTTCCTGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-849s1c1
Sequence:CCGGCCTCATGGTCTCCTTCTTCATCTCGAGATGAAGAAGGAGACCATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-900s1c1
Sequence:CCGGCCTCATCCTGATCCAGAACTTCTCGAGAAGTTCTGGATCAGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-330s1c1
Sequence:CCGGCCACCTGCTCTTCTACGTGATCTCGAGATCACGTAGAAGAGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-974s1c1
Sequence:CCGGCATTTGCTAATTCAGCCCTAACTCGAGTTAGGGCTGAATTAGCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181745
FFAR4 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-1017s21c1
Sequence:CCGGTGGGTGGTGGCCTTCACATTTCTCGAGAAATGTGAAGGCCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-717s21c1
Sequence:CCGGCTGGTCATTGTGATCAGTTACCTCGAGGTAACTGATCACAATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-617s21c1
Sequence:CCGGCGACCAGGAAATTTCGATTTGCTCGAGCAAATCGAAATTTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-557s1c1
Sequence:CCGGCCGACCAGGAAATTTCGATTTCTCGAGAAATCGAAATTTCCTGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-849s1c1
Sequence:CCGGCCTCATGGTCTCCTTCTTCATCTCGAGATGAAGAAGGAGACCATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-900s1c1
Sequence:CCGGCCTCATCCTGATCCAGAACTTCTCGAGAAGTTCTGGATCAGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-330s1c1
Sequence:CCGGCCACCTGCTCTTCTACGTGATCTCGAGATCACGTAGAAGAGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-974s1c1
Sequence:CCGGCATTTGCTAATTCAGCCCTAACTCGAGTTAGGGCTGAATTAGCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181745
FFAR4 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-1017s21c1
Sequence:CCGGTGGGTGGTGGCCTTCACATTTCTCGAGAAATGTGAAGGCCACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-717s21c1
Sequence:CCGGCTGGTCATTGTGATCAGTTACCTCGAGGTAACTGATCACAATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181745.2-617s21c1
Sequence:CCGGCGACCAGGAAATTTCGATTTGCTCGAGCAAATCGAAATTTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-557s1c1
Sequence:CCGGCCGACCAGGAAATTTCGATTTCTCGAGAAATCGAAATTTCCTGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-849s1c1
Sequence:CCGGCCTCATGGTCTCCTTCTTCATCTCGAGATGAAGAAGGAGACCATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-900s1c1
Sequence:CCGGCCTCATCCTGATCCAGAACTTCTCGAGAAGTTCTGGATCAGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-330s1c1
Sequence:CCGGCCACCTGCTCTTCTACGTGATCTCGAGATCACGTAGAAGAGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181745.1-974s1c1
Sequence:CCGGCATTTGCTAATTCAGCCCTAACTCGAGTTAGGGCTGAATTAGCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181748
FFAR4 MISSION shRNA Bacterial Glycerol Stock
free fatty acid receptor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181748.1-1253s1c1
Sequence:CCGGGCCAGCAAATTAAGGAATGATCTCGAGATCATTCCTTAATTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-123s1c1
Sequence:CCGGCCCTTTCTTCTCGGATGTCAACTCGAGTTGACATCCGAGAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-852s1c1
Sequence:CCGGGCTCATGGTTTCCTTCTTCATCTCGAGATGAAGAAGGAAACCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-1105s1c1
Sequence:CCGGCGAAATGACTTGTCTGTTATTCTCGAGAATAACAGACAAGTCATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-816s1c1
Sequence:CCGGCCAACAAGACTACCGACTCTTCTCGAGAAGAGTCGGTAGTCTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181748
FFAR4 MISSION shRNA shRNA Plasmid DNA
free fatty acid receptor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181748.1-1253s1c1
Sequence:CCGGGCCAGCAAATTAAGGAATGATCTCGAGATCATTCCTTAATTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-123s1c1
Sequence:CCGGCCCTTTCTTCTCGGATGTCAACTCGAGTTGACATCCGAGAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-852s1c1
Sequence:CCGGGCTCATGGTTTCCTTCTTCATCTCGAGATGAAGAAGGAAACCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-1105s1c1
Sequence:CCGGCGAAATGACTTGTCTGTTATTCTCGAGAATAACAGACAAGTCATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-816s1c1
Sequence:CCGGCCAACAAGACTACCGACTCTTCTCGAGAAGAGTCGGTAGTCTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181748
FFAR4 MISSION shRNA Lentiviral Transduction Particles
free fatty acid receptor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181748.1-1253s1c1
Sequence:CCGGGCCAGCAAATTAAGGAATGATCTCGAGATCATTCCTTAATTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-123s1c1
Sequence:CCGGCCCTTTCTTCTCGGATGTCAACTCGAGTTGACATCCGAGAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-852s1c1
Sequence:CCGGGCTCATGGTTTCCTTCTTCATCTCGAGATGAAGAAGGAAACCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-1105s1c1
Sequence:CCGGCGAAATGACTTGTCTGTTATTCTCGAGAATAACAGACAAGTCATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181748.1-816s1c1
Sequence:CCGGCCAACAAGACTACCGACTCTTCTCGAGAAGAGTCGGTAGTCTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks