EMAIL THIS PAGE TO A FRIEND

FGA

fibrinogen alpha chain

127 Gene Product Result for
Synonyms: Fib2
UniProtKB ID: P02671, D3DP14, D3DP15, Q4QQH7, Q9BX62, Q9UCH2
Gene ID:
Human(2243) Summary: The protein encoded by this gene is the alpha component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia, afibrinogenemia and renal amyloidosis. Alternative splicing results in two isoforms which vary in the carboxy-terminus. [provided by RefSeq, Jul 2008]
Mouse(14161) fibrinogen alpha chain
Rat(361969) fibrinogen alpha chain
sheep(101102090) fibrinogen alpha chain
Domestic Rabbit(100353616) fibrinogen alpha chain
domestic guinea pig(100720646) fibrinogen alpha chain
naked mole-rat(101697611) fibrinogen alpha chain
Zebrafish(378986) fibrinogen alpha chain
chicken(396307) fibrinogen alpha chain
dog(475473) fibrinogen alpha chain
domestic cat(101092934) fibrinogen alpha chain
Horse(100069763) fibrinogen alpha chain
cow(522039) fibrinogen alpha chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108558 Anti-FGA IgG fraction of antiserum goat, horse, pig, mouse, human, pig, rat, sheep, canine
immunohistochemistry, western blot pricing
SAB2108134 Anti-FGA antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV41758 Anti-FGA antibody produced in rabbit IgG fraction of antiserum horse, bovine, human, mouse
immunohistochemistry, western blot pricing
HPA051370 Anti-FGA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA064755 Anti-FGA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
GW22856 Anti-Fibrinogen antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
F8512 Anti-Fibrinogen antibody produced in goat whole antiserum human
ELISA, quantitative precipitin assay pricing
SAB1402193 Monoclonal Anti-FGA antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
F4639 Monoclonal Anti-Fibrinogen antibody produced in mouse clone FG-21, ascites fluid baboon, human
ELISA pricing
F9902 Monoclonal Anti-Fibrinogen antibody produced in mouse clone 85D4, ascites fluid goat, canine, human, baboon, bovine, pig, rabbit, sheep
dot blot, ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000508 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000508 Rosetta Predictions human pricing
NM_021871 Rosetta Predictions human pricing
NM_001008724 Rosetta Predictions rat pricing
NM_052797 Rosetta Predictions rat pricing
XM_579199 Rosetta Predictions rat pricing
NM_001111048 Rosetta Predictions mouse pricing
NM_010196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019693 predicted 412
2 SASI_Hs01_00019694 predicted 1705
3 SASI_Hs01_00019696 predicted 305
4 SASI_Hs01_00019699 predicted 833
5 SASI_Hs01_00019700 predicted 538
6 SASI_Hs01_00019701 predicted 662
7 SASI_Hs02_00302692 predicted 271
8 SASI_Hs02_00302693 predicted 266
9 SASI_Hs01_00019692 predicted 1354
10 SASI_Hs01_00019695 predicted 216
11 SASI_Hs01_00019697 predicted 1087
12 SASI_Hs01_00019698 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178368 predicted 415
2 SASI_Hs01_00178369 predicted 1705
3 SASI_Hs01_00178371 predicted 303
4 SASI_Hs01_00178374 predicted 830
5 SASI_Hs01_00178375 predicted 535
6 SASI_Hs01_00178376 predicted 660
7 SASI_Hs02_00355149 predicted 271
8 SASI_Hs02_00355150 predicted 263
9 SASI_Hs01_00178367 predicted 1354
10 SASI_Hs01_00178370 predicted 218
11 SASI_Hs01_00178372 predicted 1084
12 SASI_Hs01_00178373 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199247 predicted 605
2 SASI_Rn02_00199248 predicted 652
3 SASI_Rn01_00035532 predicted 394
4 SASI_Rn01_00035533 predicted 1447
5 SASI_Rn01_00035536 predicted 338
6 SASI_Rn02_00199249 predicted 269
7 SASI_Rn01_00035539 predicted 1387
8 SASI_Rn02_00199250 predicted 245
9 SASI_Rn02_00199251 predicted 330
10 SASI_Rn02_00199252 predicted 459
11 SASI_Rn01_00035531 predicted 1790
12 SASI_Rn01_00035534 predicted 1903
13 SASI_Rn01_00035535 predicted 1816
14 SASI_Rn01_00035537 predicted 2116
15 SASI_Rn01_00035538 predicted 1575
16 SASI_Rn01_00035540 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265570 predicted 602
2 SASI_Rn02_00265571 predicted 648
3 SASI_Rn02_00265572 predicted 401
4 SASI_Rn02_00265573 predicted 1447
5 SASI_Rn02_00265574 predicted 342
6 SASI_Rn02_00265575 predicted 263
7 SASI_Rn02_00265576 predicted 1384
8 SASI_Rn02_00265577 predicted 248
9 SASI_Rn02_00265578 predicted 331
10 SASI_Rn02_00265579 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168281 predicted 1787
2 SASI_Rn01_00168282 predicted 404
3 SASI_Rn01_00168283 predicted 1452
4 SASI_Rn01_00168284 predicted 1899
5 SASI_Rn01_00168285 predicted 1822
6 SASI_Rn01_00168286 predicted 345
7 SASI_Rn01_00168287 predicted 2117
8 SASI_Rn01_00168288 predicted 1574
9 SASI_Rn01_00168289 predicted 1389
10 SASI_Rn01_00168290 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306185 predicted 351
2 SASI_Mm02_00306186 predicted 1942
3 SASI_Mm02_00306187 predicted 2148
4 SASI_Mm02_00306188 predicted 633
5 SASI_Mm02_00306189 predicted 689
6 SASI_Mm02_00306190 predicted 1488
7 SASI_Mm02_00306191 predicted 1989
8 SASI_Mm02_00306192 predicted 1193
9 SASI_Mm02_00306193 predicted 365
10 SASI_Mm02_00306194 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158279 predicted 346
2 SASI_Mm01_00158280 predicted 629
3 SASI_Mm01_00158281 predicted 683
4 SASI_Mm01_00158282 predicted 1482
5 SASI_Mm01_00158283 predicted 1192
6 SASI_Mm01_00158285 predicted 362
7 SASI_Mm01_00158286 predicted 642
8 SASI_Mm01_00158287 predicted 669
9 SASI_Mm02_00318005 predicted 1198
10 SASI_Mm02_00318006 predicted 349
11 SASI_Mm01_00158284 predicted 510
12 SASI_Mm01_00158288 predicted 1507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010196
FGA MISSION shRNA Bacterial Glycerol Stock
fibrinogen alpha chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1260s1c1
Sequence:CCGGCCACACATCGTTCATGCTCTACTCGAGTAGAGCATGAACGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1468s1c1
Sequence:CCGGTGGTTTAATCTCACCTAACTTCTCGAGAAGTTAGGTGAGATTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1465s1c1
Sequence:CCGGCTTTGGTTTAATCTCACCTAACTCGAGTTAGGTGAGATTAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-414s1c1
Sequence:CCGGCCAACAACTTTGATAACACTTCTCGAGAAGTGTTATCAAAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010196.1-1809s1c1
Sequence:CCGGCCCGTTTCCTAACCTCCTTTACTCGAGTAAAGGAGGTTAGGAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010196
FGA MISSION shRNA shRNA Plasmid DNA
fibrinogen alpha chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1260s1c1
Sequence:CCGGCCACACATCGTTCATGCTCTACTCGAGTAGAGCATGAACGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1468s1c1
Sequence:CCGGTGGTTTAATCTCACCTAACTTCTCGAGAAGTTAGGTGAGATTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1465s1c1
Sequence:CCGGCTTTGGTTTAATCTCACCTAACTCGAGTTAGGTGAGATTAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-414s1c1
Sequence:CCGGCCAACAACTTTGATAACACTTCTCGAGAAGTGTTATCAAAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010196.1-1809s1c1
Sequence:CCGGCCCGTTTCCTAACCTCCTTTACTCGAGTAAAGGAGGTTAGGAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010196
FGA MISSION shRNA Lentiviral Transduction Particles
fibrinogen alpha chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1260s1c1
Sequence:CCGGCCACACATCGTTCATGCTCTACTCGAGTAGAGCATGAACGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1468s1c1
Sequence:CCGGTGGTTTAATCTCACCTAACTTCTCGAGAAGTTAGGTGAGATTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-1465s1c1
Sequence:CCGGCTTTGGTTTAATCTCACCTAACTCGAGTTAGGTGAGATTAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010196.1-414s1c1
Sequence:CCGGCCAACAACTTTGATAACACTTCTCGAGAAGTGTTATCAAAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010196.1-1809s1c1
Sequence:CCGGCCCGTTTCCTAACCTCCTTTACTCGAGTAAAGGAGGTTAGGAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000508
VALIDATED
FGA MISSION shRNA Bacterial Glycerol Stock
fibrinogen alpha chain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000508.2-2514s1c1
Sequence:CCGGCCCAAGGAATAACAGTCCTTACTCGAGTAAGGACTGTTATTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000508.2-2877s1c1
Sequence:CCGGGCCATTCAGTACATCAGGAAACTCGAGTTTCCTGATGTACTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000508.2-383s1c1
Sequence:CCGGCCTCAGCCAATAACCGTGATACTCGAGTATCACGGTTATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000508.2-2242s1c1
Sequence:CCGGGCAGAATATCACTTCCGGGTACTCGAGTACCCGGAAGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000508.2-511s1c1
Sequence:CCGGGCTCAGTTGGTTGATATGAAACTCGAGTTTCATATCAACCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000508.3-539s21c1
Sequence:CCGGGCTCAGTTGGTTGATATGAAACTCGAGTTTCATATCAACCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-411s21c1
Sequence:CCGGCCTCAGCCAATAACCGTGATACTCGAGTATCACGGTTATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000508.3-364s21c1
Sequence:CCGGTCATTCGTTGACCACTAATATCTCGAGATATTAGTGGTCAACGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-1427s21c1
Sequence:CCGGACGCGTCGTTCATGCTCTAAACTCGAGTTTAGAGCATGAACGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-261s21c1
Sequence:CCGGGCAGGATGAAAGGGTTGATTGCTCGAGCAATCAACCCTTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000508
VALIDATED
FGA MISSION shRNA shRNA Plasmid DNA
fibrinogen alpha chain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000508.2-2514s1c1
Sequence:CCGGCCCAAGGAATAACAGTCCTTACTCGAGTAAGGACTGTTATTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000508.2-2877s1c1
Sequence:CCGGGCCATTCAGTACATCAGGAAACTCGAGTTTCCTGATGTACTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000508.2-383s1c1
Sequence:CCGGCCTCAGCCAATAACCGTGATACTCGAGTATCACGGTTATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000508.2-2242s1c1
Sequence:CCGGGCAGAATATCACTTCCGGGTACTCGAGTACCCGGAAGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000508.2-511s1c1
Sequence:CCGGGCTCAGTTGGTTGATATGAAACTCGAGTTTCATATCAACCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000508.3-539s21c1
Sequence:CCGGGCTCAGTTGGTTGATATGAAACTCGAGTTTCATATCAACCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-411s21c1
Sequence:CCGGCCTCAGCCAATAACCGTGATACTCGAGTATCACGGTTATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000508.3-364s21c1
Sequence:CCGGTCATTCGTTGACCACTAATATCTCGAGATATTAGTGGTCAACGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-1427s21c1
Sequence:CCGGACGCGTCGTTCATGCTCTAAACTCGAGTTTAGAGCATGAACGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-261s21c1
Sequence:CCGGGCAGGATGAAAGGGTTGATTGCTCGAGCAATCAACCCTTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000508
VALIDATED
FGA MISSION shRNA Lentiviral Transduction Particles
fibrinogen alpha chain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000508.2-2514s1c1
Sequence:CCGGCCCAAGGAATAACAGTCCTTACTCGAGTAAGGACTGTTATTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000508.2-2877s1c1
Sequence:CCGGGCCATTCAGTACATCAGGAAACTCGAGTTTCCTGATGTACTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000508.2-383s1c1
Sequence:CCGGCCTCAGCCAATAACCGTGATACTCGAGTATCACGGTTATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000508.2-2242s1c1
Sequence:CCGGGCAGAATATCACTTCCGGGTACTCGAGTACCCGGAAGTGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000508.2-511s1c1
Sequence:CCGGGCTCAGTTGGTTGATATGAAACTCGAGTTTCATATCAACCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000508.3-539s21c1
Sequence:CCGGGCTCAGTTGGTTGATATGAAACTCGAGTTTCATATCAACCAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-411s21c1
Sequence:CCGGCCTCAGCCAATAACCGTGATACTCGAGTATCACGGTTATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000508.3-364s21c1
Sequence:CCGGTCATTCGTTGACCACTAATATCTCGAGATATTAGTGGTCAACGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-1427s21c1
Sequence:CCGGACGCGTCGTTCATGCTCTAAACTCGAGTTTAGAGCATGAACGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000508.3-261s21c1
Sequence:CCGGGCAGGATGAAAGGGTTGATTGCTCGAGCAATCAACCCTTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks