EMAIL THIS PAGE TO A FRIEND

FGB

fibrinogen beta chain

90 Gene Product Result for
UniProtKB ID: P02675, B2R7G3, Q3KPF2
Gene ID:
Human(2244) Summary: The protein encoded by this gene is the beta component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including afibrinogenemia, dysfibrinogenemia, hypodysfibrinogenemia and thrombotic tendency. [provided by RefSeq, Jul 2008]
Mouse(110135) fibrinogen beta chain
Rat(24366) fibrinogen beta chain
Zebrafish(337315) fibrinogen, B beta polypeptide
chicken(373926) fibrinogen beta chain
cow(510522) fibrinogen beta chain
Horse(100069774) fibrinogen beta chain
domestic cat(101099632) fibrinogen beta chain
dog(475472) fibrinogen beta chain
naked mole-rat(101698228) fibrinogen beta chain
domestic guinea pig(100726228) fibrinogen beta chain
sheep(101102336) fibrinogen beta chain
Domestic Rabbit(100351341) fibrinogen beta chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025461 MISSION® esiRNA esiRNA human FGB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005141 Rosetta Predictions human pricing
NM_020071 Rosetta Predictions rat pricing
NM_181849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035596 predicted 1259
2 SASI_Hs01_00035597 predicted 834
3 SASI_Hs01_00035599 predicted 819
4 SASI_Hs02_00339069 predicted 540
5 SASI_Hs01_00035600 predicted 1242
6 SASI_Hs01_00035602 predicted 917
7 SASI_Hs01_00035603 predicted 1476
8 SASI_Hs01_00035604 predicted 366
9 SASI_Hs02_00339070 predicted 1114
10 SASI_Hs01_00035605 predicted 816
11 SASI_Hs01_00035598 predicted 250
12 SASI_Hs01_00035601 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091827 predicted 281
2 SASI_Rn01_00091829 predicted 956
3 SASI_Rn01_00091830 predicted 1093
4 SASI_Rn02_00262446 predicted 389
5 SASI_Rn01_00091831 predicted 793
6 SASI_Rn01_00091833 predicted 375
7 SASI_Rn01_00091834 predicted 551
8 SASI_Rn02_00262447 predicted 334
9 SASI_Rn01_00091835 predicted 1010
10 SASI_Rn01_00091836 predicted 1260
11 SASI_Rn01_00091828 predicted 655
12 SASI_Rn01_00091832 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132740 predicted 521
2 SASI_Mm01_00132742 predicted 464
3 SASI_Mm01_00132743 predicted 797
4 SASI_Mm01_00132744 predicted 834
5 SASI_Mm01_00132745 predicted 1242
6 SASI_Mm02_00349937 predicted 473
7 SASI_Mm01_00132746 predicted 899
8 SASI_Mm01_00132747 predicted 547
9 SASI_Mm01_00132748 predicted 919
10 SASI_Mm01_00132749 predicted 783
11 SASI_Mm01_00132741 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005141
FGB MISSION shRNA Bacterial Glycerol Stock
fibrinogen beta chain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-1357s21c1
Sequence:CCGGGCCAATCCAAACGGCAGATACCTCGAGGTATCTGCCGTTTGGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-1163s21c1
Sequence:CCGGACAGAGGAACAGCCGGTAATGCTCGAGCATTACCGGCTGTTCCTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-79s21c1
Sequence:CCGGACCATGAAACATCTATTATTGCTCGAGCAATAATAGATGTTTCATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005141.1-1508s1c1
Sequence:CCGGCTTCTGTATGTGACAACATTTCTCGAGAAATGTTGTCACATACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-1387s1c1
Sequence:CCGGGCACAGATGATGGTGTAGTATCTCGAGATACTACACCATCATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-897s1c1
Sequence:CCGGGATCCATATAAACAGGGATTTCTCGAGAAATCCCTGTTTATATGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-582s1c1
Sequence:CCGGGCAACTAACCTTCGTGTGCTTCTCGAGAAGCACACGAAGGTTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-594s1c1
Sequence:CCGGCGTGTGCTTCGTTCAATCCTACTCGAGTAGGATTGAACGAAGCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005141
FGB MISSION shRNA shRNA Plasmid DNA
fibrinogen beta chain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-1357s21c1
Sequence:CCGGGCCAATCCAAACGGCAGATACCTCGAGGTATCTGCCGTTTGGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-1163s21c1
Sequence:CCGGACAGAGGAACAGCCGGTAATGCTCGAGCATTACCGGCTGTTCCTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-79s21c1
Sequence:CCGGACCATGAAACATCTATTATTGCTCGAGCAATAATAGATGTTTCATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005141.1-1508s1c1
Sequence:CCGGCTTCTGTATGTGACAACATTTCTCGAGAAATGTTGTCACATACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-1387s1c1
Sequence:CCGGGCACAGATGATGGTGTAGTATCTCGAGATACTACACCATCATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-897s1c1
Sequence:CCGGGATCCATATAAACAGGGATTTCTCGAGAAATCCCTGTTTATATGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-582s1c1
Sequence:CCGGGCAACTAACCTTCGTGTGCTTCTCGAGAAGCACACGAAGGTTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-594s1c1
Sequence:CCGGCGTGTGCTTCGTTCAATCCTACTCGAGTAGGATTGAACGAAGCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005141
FGB MISSION shRNA Lentiviral Transduction Particles
fibrinogen beta chain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-1357s21c1
Sequence:CCGGGCCAATCCAAACGGCAGATACCTCGAGGTATCTGCCGTTTGGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-1163s21c1
Sequence:CCGGACAGAGGAACAGCCGGTAATGCTCGAGCATTACCGGCTGTTCCTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005141.3-79s21c1
Sequence:CCGGACCATGAAACATCTATTATTGCTCGAGCAATAATAGATGTTTCATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005141.1-1508s1c1
Sequence:CCGGCTTCTGTATGTGACAACATTTCTCGAGAAATGTTGTCACATACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-1387s1c1
Sequence:CCGGGCACAGATGATGGTGTAGTATCTCGAGATACTACACCATCATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-897s1c1
Sequence:CCGGGATCCATATAAACAGGGATTTCTCGAGAAATCCCTGTTTATATGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-582s1c1
Sequence:CCGGGCAACTAACCTTCGTGTGCTTCTCGAGAAGCACACGAAGGTTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005141.1-594s1c1
Sequence:CCGGCGTGTGCTTCGTTCAATCCTACTCGAGTAGGATTGAACGAAGCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181849
FGB MISSION shRNA Bacterial Glycerol Stock
fibrinogen beta chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-331s1c1
Sequence:CCGGCATTGCAACAAACGTTGTTAACTCGAGTTAACAACGTTTGTTGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-1009s1c1
Sequence:CCGGCCACAGAACTTCTCATTGAAACTCGAGTTTCAATGAGAAGTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-524s1c1
Sequence:CCGGCCTGGAAGATCAGAGATTATACTCGAGTATAATCTCTGATCTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-237s1c1
Sequence:CCGGGCCAACCAGAAGAAAGTAGAACTCGAGTTCTACTTTCTTCTGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-1008s1c1
Sequence:CCGGCCCACAGAACTTCTCATTGAACTCGAGTTCAATGAGAAGTTCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181849
FGB MISSION shRNA shRNA Plasmid DNA
fibrinogen beta chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-331s1c1
Sequence:CCGGCATTGCAACAAACGTTGTTAACTCGAGTTAACAACGTTTGTTGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-1009s1c1
Sequence:CCGGCCACAGAACTTCTCATTGAAACTCGAGTTTCAATGAGAAGTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-524s1c1
Sequence:CCGGCCTGGAAGATCAGAGATTATACTCGAGTATAATCTCTGATCTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-237s1c1
Sequence:CCGGGCCAACCAGAAGAAAGTAGAACTCGAGTTCTACTTTCTTCTGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-1008s1c1
Sequence:CCGGCCCACAGAACTTCTCATTGAACTCGAGTTCAATGAGAAGTTCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181849
FGB MISSION shRNA Lentiviral Transduction Particles
fibrinogen beta chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-331s1c1
Sequence:CCGGCATTGCAACAAACGTTGTTAACTCGAGTTAACAACGTTTGTTGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-1009s1c1
Sequence:CCGGCCACAGAACTTCTCATTGAAACTCGAGTTTCAATGAGAAGTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-524s1c1
Sequence:CCGGCCTGGAAGATCAGAGATTATACTCGAGTATAATCTCTGATCTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-237s1c1
Sequence:CCGGGCCAACCAGAAGAAAGTAGAACTCGAGTTCTACTTTCTTCTGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181849.1-1008s1c1
Sequence:CCGGCCCACAGAACTTCTCATTGAACTCGAGTTCAATGAGAAGTTCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)