EMAIL THIS PAGE TO A FRIEND

FGD1

FYVE, RhoGEF and PH domain containing 1

101 Gene Product Result for
Synonyms: AAS FGDY MRXS16 ZFYVE3
UniProtKB ID: P98174, Q5H999, Q8N4D9
Gene ID:
Human(2245) Summary: This gene encodes a protein that contains Dbl (DH) and pleckstrin (PH) homology domains and is similar to the Rho family of small GTP-binding proteins. The encoded protein specifically binds to the Rho family GTPase Cdc42Hs and can stimulate the GDP-GTP exchange of the isoprenylated form of Cdc42Hs. It also stimulates the mitogen activated protein kinase cascade leading to c-Jun kinase SAPK/JNK1 activation. Defects in this gene are the cause of faciogenital dysplasia and X-linked mental retardation, syndromatic 16.[provided by RefSeq, Mar 2011]
Mouse(14163) FYVE, RhoGEF and PH domain containing 1
Rat(363460) FYVE, RhoGEF and PH domain containing 1
Zebrafish(560305) FYVE, RhoGEF and PH domain containing 1
dog(491901) FYVE, RhoGEF and PH domain containing 1
domestic cat(101094403) FYVE, RhoGEF and PH domain containing 1
cow(100124501) FYVE, RhoGEF and PH domain containing 1
sheep(101117050) FYVE, RhoGEF and PH domain containing 1
domestic guinea pig(100718541) FYVE, RhoGEF and PH domain containing 1
naked mole-rat(101720101) FYVE, RhoGEF and PH domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000911 Anti-FGD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV31673 Anti-FGD1 antibody produced in rabbit affinity isolated antibody mouse, canine, horse, rat, bovine, rabbit, human, pig
western blot pricing
SAB2100813 Anti-FGD1 antibody produced in rabbit affinity isolated antibody human, canine, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004463 Rosetta Predictions human pricing
NM_001037546 Rosetta Predictions rat pricing
NM_008001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179216 predicted 2291
2 SASI_Hs02_00337661 predicted 2588
3 SASI_Hs01_00179217 predicted 2447
4 SASI_Hs01_00179218 predicted 2535
5 SASI_Hs01_00179219 predicted 3599
6 SASI_Hs01_00179220 predicted 2431
7 SASI_Hs01_00179223 predicted 3447
8 SASI_Hs02_00337662 predicted 2665
9 SASI_Hs02_00337663 predicted 3386
10 SASI_Hs02_00337664 predicted 2011
11 SASI_Hs01_00179215 predicted 2131
12 SASI_Hs01_00179221 predicted 3243
13 SASI_Hs01_00179222 predicted 3255
14 SASI_Hs01_00179224 predicted 2307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095845 predicted 2263
2 SASI_Rn01_00095846 predicted 1197
3 SASI_Rn01_00095847 predicted 1376
4 SASI_Rn01_00095849 predicted 1491
5 SASI_Rn01_00095850 predicted 1654
6 SASI_Rn01_00095852 predicted 1535
7 SASI_Rn01_00095853 predicted 1489
8 SASI_Rn02_00204485 predicted 1569
9 SASI_Rn02_00204486 predicted 1840
10 SASI_Rn02_00204487 predicted 353
11 SASI_Rn01_00095848 predicted 1547
12 SASI_Rn01_00095851 predicted 1141
13 SASI_Rn01_00095854 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133781 predicted 2003
2 SASI_Mm01_00133782 predicted 1100
3 SASI_Mm01_00133783 predicted 2204
4 SASI_Mm01_00133784 predicted 660
5 SASI_Mm01_00133785 predicted 2198
6 SASI_Mm01_00133786 predicted 2242
7 SASI_Mm01_00133787 predicted 1073
8 SASI_Mm01_00133789 predicted 2255
9 SASI_Mm01_00133790 predicted 1049
10 SASI_Mm02_00312929 predicted 2581
11 SASI_Mm01_00133788 predicted 2357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008001
VALIDATED
FGD1 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2747s1c1
Sequence:CCGGCGACTCATCTATGACAACAATCTCGAGATTGTTGTCATAGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2243s1c1
Sequence:CCGGGCAAAGAATGGGACCACTCAACTCGAGTTGAGTGGTCCCATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2746s1c1
Sequence:CCGGCCGACTCATCTATGACAACAACTCGAGTTGTTGTCATAGATGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-1056s1c1
Sequence:CCGGGCACTAGTTCTGCAGCAGTATCTCGAGATACTGCTGCAGAACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008001.2-2072s1c1
Sequence:CCGGCAGAAGTCTTTGGAGCTGATACTCGAGTATCAGCTCCAAAGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1895s21c1
Sequence:CCGGGAGCGGTCTACCCAGTTTAAACTCGAGTTTAAACTGGGTAGACCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008001.3-2197s21c1
Sequence:CCGGTCCCACCAAAGAGCTCATAAACTCGAGTTTATGAGCTCTTTGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-2261s21c1
Sequence:CCGGCAAGATCGATACCTCATATTACTCGAGTAATATGAGGTATCGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1616s21c1
Sequence:CCGGCATCTCCTGGATCAGGTATTCCTCGAGGAATACCTGATCCAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1064s21c1
Sequence:CCGGTCTGCAGCAGTATCATCATTGCTCGAGCAATGATGATACTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008001
VALIDATED
FGD1 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2747s1c1
Sequence:CCGGCGACTCATCTATGACAACAATCTCGAGATTGTTGTCATAGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2243s1c1
Sequence:CCGGGCAAAGAATGGGACCACTCAACTCGAGTTGAGTGGTCCCATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2746s1c1
Sequence:CCGGCCGACTCATCTATGACAACAACTCGAGTTGTTGTCATAGATGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-1056s1c1
Sequence:CCGGGCACTAGTTCTGCAGCAGTATCTCGAGATACTGCTGCAGAACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008001.2-2072s1c1
Sequence:CCGGCAGAAGTCTTTGGAGCTGATACTCGAGTATCAGCTCCAAAGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1895s21c1
Sequence:CCGGGAGCGGTCTACCCAGTTTAAACTCGAGTTTAAACTGGGTAGACCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008001.3-2197s21c1
Sequence:CCGGTCCCACCAAAGAGCTCATAAACTCGAGTTTATGAGCTCTTTGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-2261s21c1
Sequence:CCGGCAAGATCGATACCTCATATTACTCGAGTAATATGAGGTATCGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1616s21c1
Sequence:CCGGCATCTCCTGGATCAGGTATTCCTCGAGGAATACCTGATCCAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1064s21c1
Sequence:CCGGTCTGCAGCAGTATCATCATTGCTCGAGCAATGATGATACTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008001
VALIDATED
FGD1 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2747s1c1
Sequence:CCGGCGACTCATCTATGACAACAATCTCGAGATTGTTGTCATAGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2243s1c1
Sequence:CCGGGCAAAGAATGGGACCACTCAACTCGAGTTGAGTGGTCCCATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-2746s1c1
Sequence:CCGGCCGACTCATCTATGACAACAACTCGAGTTGTTGTCATAGATGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008001.2-1056s1c1
Sequence:CCGGGCACTAGTTCTGCAGCAGTATCTCGAGATACTGCTGCAGAACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008001.2-2072s1c1
Sequence:CCGGCAGAAGTCTTTGGAGCTGATACTCGAGTATCAGCTCCAAAGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1895s21c1
Sequence:CCGGGAGCGGTCTACCCAGTTTAAACTCGAGTTTAAACTGGGTAGACCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008001.3-2197s21c1
Sequence:CCGGTCCCACCAAAGAGCTCATAAACTCGAGTTTATGAGCTCTTTGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-2261s21c1
Sequence:CCGGCAAGATCGATACCTCATATTACTCGAGTAATATGAGGTATCGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1616s21c1
Sequence:CCGGCATCTCCTGGATCAGGTATTCCTCGAGGAATACCTGATCCAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008001.3-1064s21c1
Sequence:CCGGTCTGCAGCAGTATCATCATTGCTCGAGCAATGATGATACTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004463
VALIDATED
FGD1 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2447s1c1
Sequence:CCGGGCTGAAGGTATATGAGCTGTTCTCGAGAACAGCTCATATACCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2957s1c1
Sequence:CCGGGCCCTTCAATTCTATCACCAACTCGAGTTGGTGATAGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-1988s1c1
Sequence:CCGGCCACGGCATCTTCTCTAACATCTCGAGATGTTAGAGAAGATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-1398s1c1
Sequence:CCGGCCTGTGATTGTCGCCTCGGATCTCGAGATCCGAGGCGACAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2561s1c1
Sequence:CCGGCCGATACCTCATACTATTCAACTCGAGTTGAATAGTATGAGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004463.2-3866s21c1
Sequence:CCGGTTGCCAGTCCTACCTGAATTACTCGAGTAATTCAGGTAGGACTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-1398s21c1
Sequence:CCGGCCTGTGATTGTCGCCTCGGATCTCGAGATCCGAGGCGACAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2957s21c1
Sequence:CCGGGCCCTTCAATTCTATCACCAACTCGAGTTGGTGATAGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2561s21c1
Sequence:CCGGCCGATACCTCATACTATTCAACTCGAGTTGAATAGTATGAGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2190s21c1
Sequence:CCGGGAGCGCTCCACCCAGTTTAAACTCGAGTTTAAACTGGGTGGAGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004463
VALIDATED
FGD1 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2447s1c1
Sequence:CCGGGCTGAAGGTATATGAGCTGTTCTCGAGAACAGCTCATATACCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2957s1c1
Sequence:CCGGGCCCTTCAATTCTATCACCAACTCGAGTTGGTGATAGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-1988s1c1
Sequence:CCGGCCACGGCATCTTCTCTAACATCTCGAGATGTTAGAGAAGATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-1398s1c1
Sequence:CCGGCCTGTGATTGTCGCCTCGGATCTCGAGATCCGAGGCGACAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2561s1c1
Sequence:CCGGCCGATACCTCATACTATTCAACTCGAGTTGAATAGTATGAGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004463.2-3866s21c1
Sequence:CCGGTTGCCAGTCCTACCTGAATTACTCGAGTAATTCAGGTAGGACTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-1398s21c1
Sequence:CCGGCCTGTGATTGTCGCCTCGGATCTCGAGATCCGAGGCGACAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2957s21c1
Sequence:CCGGGCCCTTCAATTCTATCACCAACTCGAGTTGGTGATAGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2561s21c1
Sequence:CCGGCCGATACCTCATACTATTCAACTCGAGTTGAATAGTATGAGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2190s21c1
Sequence:CCGGGAGCGCTCCACCCAGTTTAAACTCGAGTTTAAACTGGGTGGAGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004463
VALIDATED
FGD1 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2447s1c1
Sequence:CCGGGCTGAAGGTATATGAGCTGTTCTCGAGAACAGCTCATATACCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2957s1c1
Sequence:CCGGGCCCTTCAATTCTATCACCAACTCGAGTTGGTGATAGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-1988s1c1
Sequence:CCGGCCACGGCATCTTCTCTAACATCTCGAGATGTTAGAGAAGATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-1398s1c1
Sequence:CCGGCCTGTGATTGTCGCCTCGGATCTCGAGATCCGAGGCGACAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004463.2-2561s1c1
Sequence:CCGGCCGATACCTCATACTATTCAACTCGAGTTGAATAGTATGAGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004463.2-3866s21c1
Sequence:CCGGTTGCCAGTCCTACCTGAATTACTCGAGTAATTCAGGTAGGACTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-1398s21c1
Sequence:CCGGCCTGTGATTGTCGCCTCGGATCTCGAGATCCGAGGCGACAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2957s21c1
Sequence:CCGGGCCCTTCAATTCTATCACCAACTCGAGTTGGTGATAGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2561s21c1
Sequence:CCGGCCGATACCTCATACTATTCAACTCGAGTTGAATAGTATGAGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004463.2-2190s21c1
Sequence:CCGGGAGCGCTCCACCCAGTTTAAACTCGAGTTTAAACTGGGTGGAGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks