EMAIL THIS PAGE TO A FRIEND

FGD2

FYVE, RhoGEF and PH domain containing 2

50 Gene Product Result for
Synonyms: ZFYVE4
Gene ID:
Mouse(26382) FYVE, RhoGEF and PH domain containing 2
Rat(309653) FYVE, RhoGEF and PH domain containing 2
domestic guinea pig(100724313) FYVE, RhoGEF and PH domain containing 2
sheep(101103192) FYVE, RhoGEF and PH domain containing 2
Domestic Rabbit(100342384) FYVE, RhoGEF and PH domain containing 2
domestic cat(101082403) FYVE, RhoGEF and PH domain containing 2
cow(512593) FYVE, RhoGEF and PH domain containing 2
Horse(100064178) FYVE, RhoGEF and PH domain containing 2
dog(481771) FYVE, RhoGEF and PH domain containing 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173558 Rosetta Predictions human pricing
NM_001107617 Rosetta Predictions rat pricing
NM_013710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095744 predicted 532
2 SASI_Hs01_00095745 predicted 1029
3 SASI_Hs01_00095746 predicted 378
4 SASI_Hs01_00095747 predicted 1413
5 SASI_Hs01_00095748 predicted 201
6 SASI_Hs01_00095749 predicted 1698
7 SASI_Hs01_00095750 predicted 1400
8 SASI_Hs01_00095752 predicted 1297
9 SASI_Hs01_00095753 predicted 265
10 SASI_Hs02_00368373 predicted 808
11 SASI_Hs01_00095751 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230595 predicted 380
2 SASI_Rn02_00230596 predicted 1381
3 SASI_Rn02_00230597 predicted 1144
4 SASI_Rn02_00230598 predicted 2169
5 SASI_Rn02_00230599 predicted 1418
6 SASI_Rn02_00230600 predicted 2230
7 SASI_Rn02_00230601 predicted 658
8 SASI_Rn02_00230602 predicted 643
9 SASI_Rn02_00230603 predicted 1109
10 SASI_Rn02_00230604 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068325 predicted 1628
2 SASI_Mm01_00068326 predicted 336
3 SASI_Mm01_00068328 predicted 1425
4 SASI_Mm01_00068329 predicted 1288
5 SASI_Mm01_00068331 predicted 1931
6 SASI_Mm01_00068332 predicted 2033
7 SASI_Mm01_00068333 predicted 1182
8 SASI_Mm01_00068334 predicted 1724
9 SASI_Mm02_00322620 predicted 1709
10 SASI_Mm02_00322621 predicted 2072
11 SASI_Mm01_00068327 predicted 381
12 SASI_Mm01_00068330 predicted 2130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013710
VALIDATED
FGD2 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-1662s21c1
Sequence:CCGGTACCGTGCGGAGCTGAAATATCTCGAGATATTTCAGCTCCGCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013710.4-2458s21c1
Sequence:CCGGCATAAACTGGGCATGGTAATACTCGAGTATTACCATGCCCAGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-936s21c1
Sequence:CCGGGAACTGCTGCTCAAGGAATATCTCGAGATATTCCTTGAGCAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-398s21c1
Sequence:CCGGTTCCCTCAAGAACAAGTTATCCTCGAGGATAACTTGTTCTTGAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-254s21c1
Sequence:CCGGAGAAGCACCTGGATCCCATAGCTCGAGCTATGGGATCCAGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-2114s21c1
Sequence:CCGGTGAGGGACCTGACGAAGAAGACTCGAGTCTTCTTCGTCAGGTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013710.1-2348s1c1
Sequence:CCGGTGCCCATCTAACATGGATGAACTCGAGTTCATCCATGTTAGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013710.1-2181s1c1
Sequence:CCGGCTGATGTCTATACCGAGACAACTCGAGTTGTCTCGGTATAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013710.1-2182s1c1
Sequence:CCGGTGATGTCTATACCGAGACAATCTCGAGATTGTCTCGGTATAGACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013710.1-1659s1c1
Sequence:CCGGGCTACACATTTCTCACTGGAACTCGAGTTCCAGTGAGAAATGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013710
VALIDATED
FGD2 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-1662s21c1
Sequence:CCGGTACCGTGCGGAGCTGAAATATCTCGAGATATTTCAGCTCCGCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013710.4-2458s21c1
Sequence:CCGGCATAAACTGGGCATGGTAATACTCGAGTATTACCATGCCCAGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-936s21c1
Sequence:CCGGGAACTGCTGCTCAAGGAATATCTCGAGATATTCCTTGAGCAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-398s21c1
Sequence:CCGGTTCCCTCAAGAACAAGTTATCCTCGAGGATAACTTGTTCTTGAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-254s21c1
Sequence:CCGGAGAAGCACCTGGATCCCATAGCTCGAGCTATGGGATCCAGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-2114s21c1
Sequence:CCGGTGAGGGACCTGACGAAGAAGACTCGAGTCTTCTTCGTCAGGTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013710.1-2348s1c1
Sequence:CCGGTGCCCATCTAACATGGATGAACTCGAGTTCATCCATGTTAGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013710.1-2181s1c1
Sequence:CCGGCTGATGTCTATACCGAGACAACTCGAGTTGTCTCGGTATAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013710.1-2182s1c1
Sequence:CCGGTGATGTCTATACCGAGACAATCTCGAGATTGTCTCGGTATAGACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013710.1-1659s1c1
Sequence:CCGGGCTACACATTTCTCACTGGAACTCGAGTTCCAGTGAGAAATGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013710
VALIDATED
FGD2 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-1662s21c1
Sequence:CCGGTACCGTGCGGAGCTGAAATATCTCGAGATATTTCAGCTCCGCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013710.4-2458s21c1
Sequence:CCGGCATAAACTGGGCATGGTAATACTCGAGTATTACCATGCCCAGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-936s21c1
Sequence:CCGGGAACTGCTGCTCAAGGAATATCTCGAGATATTCCTTGAGCAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-398s21c1
Sequence:CCGGTTCCCTCAAGAACAAGTTATCCTCGAGGATAACTTGTTCTTGAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-254s21c1
Sequence:CCGGAGAAGCACCTGGATCCCATAGCTCGAGCTATGGGATCCAGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013710.4-2114s21c1
Sequence:CCGGTGAGGGACCTGACGAAGAAGACTCGAGTCTTCTTCGTCAGGTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013710.1-2348s1c1
Sequence:CCGGTGCCCATCTAACATGGATGAACTCGAGTTCATCCATGTTAGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013710.1-2181s1c1
Sequence:CCGGCTGATGTCTATACCGAGACAACTCGAGTTGTCTCGGTATAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013710.1-2182s1c1
Sequence:CCGGTGATGTCTATACCGAGACAATCTCGAGATTGTCTCGGTATAGACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013710.1-1659s1c1
Sequence:CCGGGCTACACATTTCTCACTGGAACTCGAGTTCCAGTGAGAAATGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173558
FGD2 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-1662s1c1
Sequence:CCGGCGAACTGAAATACGACGACAACTCGAGTTGTCGTCGTATTTCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-1426s1c1
Sequence:CCGGCAAATCGAGAAGCGGAATGAACTCGAGTTCATTCCGCTTCTCGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-214s1c1
Sequence:CCGGCTGGTCACTGTGTTTGAGAATCTCGAGATTCTCAAACACAGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-384s1c1
Sequence:CCGGGTACCTGAACTCCCTGAAGAACTCGAGTTCTTCAGGGAGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-635s1c1
Sequence:CCGGCCTCCATCTATCAGTTCCATTCTCGAGAATGGAACTGATAGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173558
FGD2 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-1662s1c1
Sequence:CCGGCGAACTGAAATACGACGACAACTCGAGTTGTCGTCGTATTTCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-1426s1c1
Sequence:CCGGCAAATCGAGAAGCGGAATGAACTCGAGTTCATTCCGCTTCTCGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-214s1c1
Sequence:CCGGCTGGTCACTGTGTTTGAGAATCTCGAGATTCTCAAACACAGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-384s1c1
Sequence:CCGGGTACCTGAACTCCCTGAAGAACTCGAGTTCTTCAGGGAGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-635s1c1
Sequence:CCGGCCTCCATCTATCAGTTCCATTCTCGAGAATGGAACTGATAGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173558
FGD2 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-1662s1c1
Sequence:CCGGCGAACTGAAATACGACGACAACTCGAGTTGTCGTCGTATTTCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-1426s1c1
Sequence:CCGGCAAATCGAGAAGCGGAATGAACTCGAGTTCATTCCGCTTCTCGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-214s1c1
Sequence:CCGGCTGGTCACTGTGTTTGAGAATCTCGAGATTCTCAAACACAGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-384s1c1
Sequence:CCGGGTACCTGAACTCCCTGAAGAACTCGAGTTCTTCAGGGAGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173558.2-635s1c1
Sequence:CCGGCCTCCATCTATCAGTTCCATTCTCGAGAATGGAACTGATAGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks