EMAIL THIS PAGE TO A FRIEND

FGD3

FYVE, RhoGEF and PH domain containing 3

59 Gene Product Result for
Synonyms: ZFYVE5
UniProtKB ID: Q5JSP0, Q4VX84, Q7Z7D9, Q8N5G1
Gene ID:
Mouse(30938) FYVE, RhoGEF and PH domain containing 3
Rat(361223) FYVE, RhoGEF and PH domain containing 3
chicken(415989) FYVE, RhoGEF and PH domain containing 3
cow(512950) FYVE, RhoGEF and PH domain containing 3
domestic cat(101091907) FYVE, RhoGEF and PH domain containing 3
dog(484213) FYVE, RhoGEF and PH domain containing 3
sheep(101107664) FYVE, RhoGEF and PH domain containing 3
Domestic Rabbit(100358225) FYVE, RhoGEF and PH domain containing 3
domestic guinea pig(100723357) FYVE, RhoGEF and PH domain containing 3
naked mole-rat(101725668) FYVE, RhoGEF and PH domain containing 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033086 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074451 MISSION® esiRNA esiRNA human FGD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083536 Rosetta Predictions human pricing
NM_033086 Rosetta Predictions human pricing
NM_001108409 Rosetta Predictions rat pricing
NM_015759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316940 predicted 1536
2 SASI_Hs02_00316941 predicted 2204
3 SASI_Hs02_00316942 predicted 1213
4 SASI_Hs02_00316943 predicted 1261
5 SASI_Hs02_00316944 predicted 657
6 SASI_Hs02_00316945 predicted 1640
7 SASI_Hs02_00316946 predicted 2045
8 SASI_Hs02_00316947 predicted 1729
9 SASI_Hs02_00316948 predicted 1921
10 SASI_Hs02_00316949 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240956 predicted 1434
2 SASI_Hs01_00240957 predicted 2096
3 SASI_Hs01_00240958 predicted 1110
4 SASI_Hs01_00240959 predicted 1157
5 SASI_Hs01_00240960 predicted 559
6 SASI_Hs01_00240961 predicted 1531
7 SASI_Hs01_00240962 predicted 1944
8 SASI_Hs01_00240963 predicted 1633
9 SASI_Hs01_00240964 predicted 1823
10 SASI_Hs02_00360790 predicted 715
11 SASI_Hs01_00240965 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238379 predicted 2324
2 SASI_Rn02_00238380 predicted 1276
3 SASI_Rn02_00238381 predicted 1546
4 SASI_Rn02_00238382 predicted 1400
5 SASI_Rn02_00238383 predicted 2320
6 SASI_Rn02_00238384 predicted 1351
7 SASI_Rn02_00238385 predicted 1532
8 SASI_Rn02_00238386 predicted 2391
9 SASI_Rn02_00238387 predicted 1383
10 SASI_Rn02_00238388 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185742 predicted 1475
2 SASI_Mm01_00185743 predicted 1495
3 SASI_Mm01_00185744 predicted 1850
4 SASI_Mm01_00185745 predicted 1120
5 SASI_Mm01_00185746 predicted 2461
6 SASI_Mm01_00185748 predicted 2506
7 SASI_Mm02_00323091 predicted 935
8 SASI_Mm01_00185749 predicted 1825
9 SASI_Mm01_00185750 predicted 1447
10 SASI_Mm01_00185751 predicted 1404
11 SASI_Mm01_00185747 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015759
VALIDATED
FGD3 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015759.1-1530s1c1
Sequence:CCGGCAGGTACAAGATATTGTGAAACTCGAGTTTCACAATATCTTGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-1529s1c1
Sequence:CCGGCCAGGTACAAGATATTGTGAACTCGAGTTCACAATATCTTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-471s1c1
Sequence:CCGGCCCAACAGAGACAGTGGAATTCTCGAGAATTCCACTGTCTCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015759.1-2497s1c1
Sequence:CCGGCTGCTATATTTGGCCTGTGTTCTCGAGAACACAGGCCAAATATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-1943s1c1
Sequence:CCGGCTGTAGGAAGTGCTCAGAGTTCTCGAGAACTCTGAGCACTTCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015759
VALIDATED
FGD3 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015759.1-1530s1c1
Sequence:CCGGCAGGTACAAGATATTGTGAAACTCGAGTTTCACAATATCTTGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-1529s1c1
Sequence:CCGGCCAGGTACAAGATATTGTGAACTCGAGTTCACAATATCTTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-471s1c1
Sequence:CCGGCCCAACAGAGACAGTGGAATTCTCGAGAATTCCACTGTCTCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015759.1-2497s1c1
Sequence:CCGGCTGCTATATTTGGCCTGTGTTCTCGAGAACACAGGCCAAATATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-1943s1c1
Sequence:CCGGCTGTAGGAAGTGCTCAGAGTTCTCGAGAACTCTGAGCACTTCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015759
VALIDATED
FGD3 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015759.1-1530s1c1
Sequence:CCGGCAGGTACAAGATATTGTGAAACTCGAGTTTCACAATATCTTGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-1529s1c1
Sequence:CCGGCCAGGTACAAGATATTGTGAACTCGAGTTCACAATATCTTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-471s1c1
Sequence:CCGGCCCAACAGAGACAGTGGAATTCTCGAGAATTCCACTGTCTCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015759.1-2497s1c1
Sequence:CCGGCTGCTATATTTGGCCTGTGTTCTCGAGAACACAGGCCAAATATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015759.1-1943s1c1
Sequence:CCGGCTGTAGGAAGTGCTCAGAGTTCTCGAGAACTCTGAGCACTTCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033086
FGD3 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1045s1c1
Sequence:CCGGCAGAAGTCATCATGGGCATATCTCGAGATATGCCCATGATGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1055s1c1
Sequence:CCGGCATGGGCATATTCTCTAACATCTCGAGATGTTAGAGAATATGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1205s1c1
Sequence:CCGGCGGCGAGTATGTCAAGAACTTCTCGAGAAGTTCTTGACATACTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1710s21c1
Sequence:CCGGGTTCAACAGCATGATCCTTTACTCGAGTAAAGGATCATGCTGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033086.2-2963s21c1
Sequence:CCGGCAAAGTAACCATCATCCATATCTCGAGATATGGATGATGGTTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1110s21c1
Sequence:CCGGAGAAGTCATCATGGGCATATTCTCGAGAATATGCCCATGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-717s21c1
Sequence:CCGGAGAGCTGAGTGGTAGCTTAAACTCGAGTTTAAGCTACCACTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1829s21c1
Sequence:CCGGCAGCACATACATTCATCATAACTCGAGTTATGATGAATGTATGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033086
FGD3 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1045s1c1
Sequence:CCGGCAGAAGTCATCATGGGCATATCTCGAGATATGCCCATGATGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1055s1c1
Sequence:CCGGCATGGGCATATTCTCTAACATCTCGAGATGTTAGAGAATATGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1205s1c1
Sequence:CCGGCGGCGAGTATGTCAAGAACTTCTCGAGAAGTTCTTGACATACTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1710s21c1
Sequence:CCGGGTTCAACAGCATGATCCTTTACTCGAGTAAAGGATCATGCTGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033086.2-2963s21c1
Sequence:CCGGCAAAGTAACCATCATCCATATCTCGAGATATGGATGATGGTTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1110s21c1
Sequence:CCGGAGAAGTCATCATGGGCATATTCTCGAGAATATGCCCATGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-717s21c1
Sequence:CCGGAGAGCTGAGTGGTAGCTTAAACTCGAGTTTAAGCTACCACTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1829s21c1
Sequence:CCGGCAGCACATACATTCATCATAACTCGAGTTATGATGAATGTATGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033086
FGD3 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1045s1c1
Sequence:CCGGCAGAAGTCATCATGGGCATATCTCGAGATATGCCCATGATGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1055s1c1
Sequence:CCGGCATGGGCATATTCTCTAACATCTCGAGATGTTAGAGAATATGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033086.1-1205s1c1
Sequence:CCGGCGGCGAGTATGTCAAGAACTTCTCGAGAAGTTCTTGACATACTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1710s21c1
Sequence:CCGGGTTCAACAGCATGATCCTTTACTCGAGTAAAGGATCATGCTGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033086.2-2963s21c1
Sequence:CCGGCAAAGTAACCATCATCCATATCTCGAGATATGGATGATGGTTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1110s21c1
Sequence:CCGGAGAAGTCATCATGGGCATATTCTCGAGAATATGCCCATGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-717s21c1
Sequence:CCGGAGAGCTGAGTGGTAGCTTAAACTCGAGTTTAAGCTACCACTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033086.2-1829s21c1
Sequence:CCGGCAGCACATACATTCATCATAACTCGAGTTATGATGAATGTATGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks