EMAIL THIS PAGE TO A FRIEND

FGD4

FYVE, RhoGEF and PH domain containing 4

108 Gene Product Result for
Synonyms: CMT4H FRABP ZFYVE6
UniProtKB ID: Q96M96, Q6ULS2, Q8TCP6
Gene ID:
Human(121512) Summary: This gene encodes a protein that is involved in the regulation of the actin cytoskeleton and cell shape. This protein contains an actin filament-binding domain, which together with its Dbl homology domain and one of its pleckstrin homology domains, can form microspikes. This protein can activate MAPK8 independently of the actin filament-binding domain, and it is also involved in the activation of CDC42 via the exchange of bound GDP for free GTP. The activation of CDC42 also enables this protein to play a role in mediating the cellular invasion of Cryptosporidium parvum, an intracellular parasite that infects the gastrointestinal tract. Mutations in this gene can cause Charcot-Marie-Tooth disease type 4H (CMT4H), a disorder of the peripheral nervous system. [provided by RefSeq, Oct 2008]
Mouse(224014) FYVE, RhoGEF and PH domain containing 4
Rat(246174) FYVE, RhoGEF and PH domain containing 4
naked mole-rat(101712073) FYVE, RhoGEF and PH domain containing 4
domestic guinea pig(100733109) FYVE, RhoGEF and PH domain containing 4
sheep(101105233) FYVE, RhoGEF and PH domain containing 4
chicken(418133) FYVE, RhoGEF and PH domain containing 4
cow(505234) FYVE, RhoGEF and PH domain containing 4
Horse(100070016) FYVE, RhoGEF and PH domain containing 4
domestic cat(101090877) FYVE, RhoGEF and PH domain containing 4
dog(486615) FYVE, RhoGEF and PH domain containing 4
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058211 MISSION® esiRNA esiRNA human FGD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139241 Rosetta Predictions human pricing
NM_139263 Rosetta Predictions rat pricing
NM_139232 Rosetta Predictions mouse pricing
NM_139233 Rosetta Predictions mouse pricing
NM_139234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087210 predicted 1481
2 SASI_Hs01_00087212 predicted 1285
3 SASI_Hs02_00364241 predicted 2203
4 SASI_Hs01_00087213 predicted 1299
5 SASI_Hs01_00087214 predicted 2082
6 SASI_Hs01_00087215 predicted 1433
7 SASI_Hs02_00364242 predicted 2604
8 SASI_Hs01_00087217 predicted 1076
9 SASI_Hs01_00087218 predicted 1817
10 SASI_Hs02_00364243 predicted 1380
11 SASI_Hs01_00087211 predicted 1524
12 SASI_Hs01_00087216 predicted 1262
13 SASI_Hs01_00087219 predicted 2256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093779 predicted 2804
2 SASI_Rn01_00093780 predicted 1399
3 SASI_Rn01_00093781 predicted 1406
4 SASI_Rn01_00093782 predicted 1749
5 SASI_Rn02_00268557 predicted 3660
6 SASI_Rn01_00093784 predicted 2508
7 SASI_Rn01_00093786 predicted 3522
8 SASI_Rn01_00093787 predicted 2165
9 SASI_Rn01_00093788 predicted 2170
10 SASI_Rn02_00268558 predicted 3315
11 SASI_Rn01_00093783 predicted 3097
12 SASI_Rn01_00093785 predicted 2586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170103 predicted 570
2 SASI_Mm01_00170104 predicted 1144
3 SASI_Mm01_00170105 predicted 727
4 SASI_Mm01_00170106 predicted 1215
5 SASI_Mm01_00170107 predicted 805
6 SASI_Mm01_00170108 predicted 1567
7 SASI_Mm01_00170109 predicted 1379
8 SASI_Mm01_00170110 predicted 1559
9 SASI_Mm01_00170111 predicted 691
10 SASI_Mm01_00170112 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140297 predicted 468
2 SASI_Mm01_00140298 predicted 1040
3 SASI_Mm01_00140299 predicted 623
4 SASI_Mm01_00140300 predicted 1113
5 SASI_Mm01_00140301 predicted 696
6 SASI_Mm01_00140302 predicted 1464
7 SASI_Mm01_00140303 predicted 1277
8 SASI_Mm01_00140304 predicted 1461
9 SASI_Mm01_00140305 predicted 593
10 SASI_Mm01_00140306 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091028 predicted 616
2 SASI_Mm01_00091029 predicted 1196
3 SASI_Mm01_00091030 predicted 779
4 SASI_Mm01_00091031 predicted 1270
5 SASI_Mm01_00091032 predicted 848
6 SASI_Mm01_00091033 predicted 1610
7 SASI_Mm01_00091034 predicted 1425
8 SASI_Mm01_00091035 predicted 1609
9 SASI_Mm01_00091036 predicted 739
10 SASI_Mm01_00091037 predicted 1215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139241
FGD4 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139241.2-2202s21c1
Sequence:CCGGGACACGAAGGAGGCATCATTGCTCGAGCAATGATGCCTCCTTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139241.2-738s21c1
Sequence:CCGGTTGTGTGGCCAACGGTGTAATCTCGAGATTACACCGTTGGCCACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139241.2-3076s21c1
Sequence:CCGGAGAATGAGCACTTCCATTTAACTCGAGTTAAATGGAAGTGCTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-785s1c1
Sequence:CCGGCCCTTGCTTGATACGCACATACTCGAGTATGTGCGTATCAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1012s1c1
Sequence:CCGGCCATGAGATGAAGGAGACTAACTCGAGTTAGTCTCCTTCATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-2095s1c1
Sequence:CCGGCCGAGATAATGAAGTGACAATCTCGAGATTGTCACTTCATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1587s1c1
Sequence:CCGGGCCATTCTAATAGTGCAATAACTCGAGTTATTGCACTATTAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1197s1c1
Sequence:CCGGCATCAATAAATGCCTTCCATACTCGAGTATGGAAGGCATTTATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139241
FGD4 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139241.2-2202s21c1
Sequence:CCGGGACACGAAGGAGGCATCATTGCTCGAGCAATGATGCCTCCTTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139241.2-738s21c1
Sequence:CCGGTTGTGTGGCCAACGGTGTAATCTCGAGATTACACCGTTGGCCACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139241.2-3076s21c1
Sequence:CCGGAGAATGAGCACTTCCATTTAACTCGAGTTAAATGGAAGTGCTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-785s1c1
Sequence:CCGGCCCTTGCTTGATACGCACATACTCGAGTATGTGCGTATCAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1012s1c1
Sequence:CCGGCCATGAGATGAAGGAGACTAACTCGAGTTAGTCTCCTTCATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-2095s1c1
Sequence:CCGGCCGAGATAATGAAGTGACAATCTCGAGATTGTCACTTCATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1587s1c1
Sequence:CCGGGCCATTCTAATAGTGCAATAACTCGAGTTATTGCACTATTAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1197s1c1
Sequence:CCGGCATCAATAAATGCCTTCCATACTCGAGTATGGAAGGCATTTATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139241
FGD4 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139241.2-2202s21c1
Sequence:CCGGGACACGAAGGAGGCATCATTGCTCGAGCAATGATGCCTCCTTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139241.2-738s21c1
Sequence:CCGGTTGTGTGGCCAACGGTGTAATCTCGAGATTACACCGTTGGCCACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139241.2-3076s21c1
Sequence:CCGGAGAATGAGCACTTCCATTTAACTCGAGTTAAATGGAAGTGCTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-785s1c1
Sequence:CCGGCCCTTGCTTGATACGCACATACTCGAGTATGTGCGTATCAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1012s1c1
Sequence:CCGGCCATGAGATGAAGGAGACTAACTCGAGTTAGTCTCCTTCATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-2095s1c1
Sequence:CCGGCCGAGATAATGAAGTGACAATCTCGAGATTGTCACTTCATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1587s1c1
Sequence:CCGGGCCATTCTAATAGTGCAATAACTCGAGTTATTGCACTATTAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139241.1-1197s1c1
Sequence:CCGGCATCAATAAATGCCTTCCATACTCGAGTATGGAAGGCATTTATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139232
VALIDATED
FGD4 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139232.2-915s21c1
Sequence:CCGGATGAAGTGAAGGAGACTAATGCTCGAGCATTAGTCTCCTTCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139232.2-1229s21c1
Sequence:CCGGTACGTGAAGGGATTTGATAATCTCGAGATTATCAAATCCCTTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139232.2-2904s21c1
Sequence:CCGGGAATCACTACCTGGTTATAATCTCGAGATTATAACCAGGTAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-2654s1c1
Sequence:CCGGCCAGTAATACACATAGCTCAACTCGAGTTGAGCTATGTGTATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-442s1c1
Sequence:CCGGGCAGAAAGATTCTACTATGAACTCGAGTTCATAGTAGAATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139232.1-1288s1c1
Sequence:CCGGCCAGTTTAAATCAGTGACTGACTCGAGTCAGTCACTGATTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-1868s1c1
Sequence:CCGGGCCCTTCAAGAAAGTATTGATCTCGAGATCAATACTTTCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139232.1-1110s1c1
Sequence:CCGGCCTTCCATAGTAAATTCCTATCTCGAGATAGGAATTTACTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139232
VALIDATED
FGD4 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139232.2-915s21c1
Sequence:CCGGATGAAGTGAAGGAGACTAATGCTCGAGCATTAGTCTCCTTCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139232.2-1229s21c1
Sequence:CCGGTACGTGAAGGGATTTGATAATCTCGAGATTATCAAATCCCTTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139232.2-2904s21c1
Sequence:CCGGGAATCACTACCTGGTTATAATCTCGAGATTATAACCAGGTAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-2654s1c1
Sequence:CCGGCCAGTAATACACATAGCTCAACTCGAGTTGAGCTATGTGTATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-442s1c1
Sequence:CCGGGCAGAAAGATTCTACTATGAACTCGAGTTCATAGTAGAATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139232.1-1288s1c1
Sequence:CCGGCCAGTTTAAATCAGTGACTGACTCGAGTCAGTCACTGATTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-1868s1c1
Sequence:CCGGGCCCTTCAAGAAAGTATTGATCTCGAGATCAATACTTTCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139232.1-1110s1c1
Sequence:CCGGCCTTCCATAGTAAATTCCTATCTCGAGATAGGAATTTACTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139232
VALIDATED
FGD4 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139232.2-915s21c1
Sequence:CCGGATGAAGTGAAGGAGACTAATGCTCGAGCATTAGTCTCCTTCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139232.2-1229s21c1
Sequence:CCGGTACGTGAAGGGATTTGATAATCTCGAGATTATCAAATCCCTTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139232.2-2904s21c1
Sequence:CCGGGAATCACTACCTGGTTATAATCTCGAGATTATAACCAGGTAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-2654s1c1
Sequence:CCGGCCAGTAATACACATAGCTCAACTCGAGTTGAGCTATGTGTATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-442s1c1
Sequence:CCGGGCAGAAAGATTCTACTATGAACTCGAGTTCATAGTAGAATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139232.1-1288s1c1
Sequence:CCGGCCAGTTTAAATCAGTGACTGACTCGAGTCAGTCACTGATTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139232.1-1868s1c1
Sequence:CCGGGCCCTTCAAGAAAGTATTGATCTCGAGATCAATACTTTCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139232.1-1110s1c1
Sequence:CCGGCCTTCCATAGTAAATTCCTATCTCGAGATAGGAATTTACTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks