EMAIL THIS PAGE TO A FRIEND

FGD5

FYVE, RhoGEF and PH domain containing 5

88 Gene Product Result for
Synonyms: ZFYVE23
Gene ID:
Mouse(232237) FYVE, RhoGEF and PH domain containing 5
Rat(362402) FYVE, RhoGEF and PH domain containing 5
chicken(416130) FYVE, RhoGEF and PH domain containing 5
cow(539766) FYVE, RhoGEF and PH domain containing 5
Horse(100055962) FYVE, RhoGEF and PH domain containing 5
domestic cat(101100875) FYVE, RhoGEF and PH domain containing 5
dog(484640) FYVE, RhoGEF and PH domain containing 5
sheep(101108865) FYVE, RhoGEF and PH domain containing 5
domestic guinea pig(100718171) FYVE, RhoGEF and PH domain containing 5
naked mole-rat(101702321) FYVE, RhoGEF and PH domain containing 5
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152536 Rosetta Predictions human pricing
NM_001108637 Rosetta Predictions rat pricing
NM_172731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101465 predicted 4035
2 SASI_Hs02_00366335 predicted 1763
3 SASI_Hs01_00101466 predicted 3574
4 SASI_Hs01_00101467 predicted 4152
5 SASI_Hs01_00101468 predicted 4171
6 SASI_Hs01_00101469 predicted 1744
7 SASI_Hs01_00101470 predicted 4231
8 SASI_Hs01_00101471 predicted 3952
9 SASI_Hs01_00101472 predicted 2917
10 SASI_Hs01_00101473 predicted 3602
11 SASI_Hs01_00101474 predicted 2495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240589 predicted 279
2 SASI_Rn02_00240590 predicted 785
3 SASI_Rn02_00240591 predicted 1397
4 SASI_Rn02_00240592 predicted 1964
5 SASI_Rn02_00240593 predicted 1401
6 SASI_Rn02_00240594 predicted 1190
7 SASI_Rn02_00240595 predicted 1659
8 SASI_Rn02_00240596 predicted 550
9 SASI_Rn02_00240597 predicted 1977
10 SASI_Rn02_00240598 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149029 predicted 2168
2 SASI_Mm01_00149030 predicted 3626
3 SASI_Mm01_00149031 predicted 4010
4 SASI_Mm02_00344540 predicted 3012
5 SASI_Mm02_00344541 predicted 4240
6 SASI_Mm01_00149033 predicted 3352
7 SASI_Mm01_00149034 predicted 1387
8 SASI_Mm01_00149035 predicted 2981
9 SASI_Mm01_00149037 predicted 3340
10 SASI_Mm01_00149038 predicted 4231
11 SASI_Mm01_00149032 predicted 797
12 SASI_Mm01_00149036 predicted 4197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152536
FGD5 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152536.2-4403s1c1
Sequence:CCGGCCACCCAGTAATAAACTATTTCTCGAGAAATAGTTTATTACTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-864s1c1
Sequence:CCGGCCTCTTTCTGAATCAGCGAAACTCGAGTTTCGCTGATTCAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-1742s1c1
Sequence:CCGGCCTGGCACTGACGTTTAAGAACTCGAGTTCTTAAACGTCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-3164s1c1
Sequence:CCGGCCGGCACCTATTTCTGATGAACTCGAGTTCATCAGAAATAGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-4039s1c1
Sequence:CCGGGCAGTGAAGTAGGACCTATTTCTCGAGAAATAGGTCCTACTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152536.3-3252s21c1
Sequence:CCGGGTGCTCCTCACAGACTATTTACTCGAGTAAATAGTCTGTGAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152536.3-3153s21c1
Sequence:CCGGGCAGCTGCTGTCCGTGAATTTCTCGAGAAATTCACGGACAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152536
FGD5 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152536.2-4403s1c1
Sequence:CCGGCCACCCAGTAATAAACTATTTCTCGAGAAATAGTTTATTACTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-864s1c1
Sequence:CCGGCCTCTTTCTGAATCAGCGAAACTCGAGTTTCGCTGATTCAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-1742s1c1
Sequence:CCGGCCTGGCACTGACGTTTAAGAACTCGAGTTCTTAAACGTCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-3164s1c1
Sequence:CCGGCCGGCACCTATTTCTGATGAACTCGAGTTCATCAGAAATAGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-4039s1c1
Sequence:CCGGGCAGTGAAGTAGGACCTATTTCTCGAGAAATAGGTCCTACTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152536.3-3252s21c1
Sequence:CCGGGTGCTCCTCACAGACTATTTACTCGAGTAAATAGTCTGTGAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152536.3-3153s21c1
Sequence:CCGGGCAGCTGCTGTCCGTGAATTTCTCGAGAAATTCACGGACAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152536
FGD5 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152536.2-4403s1c1
Sequence:CCGGCCACCCAGTAATAAACTATTTCTCGAGAAATAGTTTATTACTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-864s1c1
Sequence:CCGGCCTCTTTCTGAATCAGCGAAACTCGAGTTTCGCTGATTCAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-1742s1c1
Sequence:CCGGCCTGGCACTGACGTTTAAGAACTCGAGTTCTTAAACGTCAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-3164s1c1
Sequence:CCGGCCGGCACCTATTTCTGATGAACTCGAGTTCATCAGAAATAGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152536.2-4039s1c1
Sequence:CCGGGCAGTGAAGTAGGACCTATTTCTCGAGAAATAGGTCCTACTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152536.3-3252s21c1
Sequence:CCGGGTGCTCCTCACAGACTATTTACTCGAGTAAATAGTCTGTGAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152536.3-3153s21c1
Sequence:CCGGGCAGCTGCTGTCCGTGAATTTCTCGAGAAATTCACGGACAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172731
FGD5 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172731.2-4619s1c1
Sequence:CCGGGCTGTGTATCTAAGCACTTTACTCGAGTAAAGTGCTTAGATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-2918s1c1
Sequence:CCGGCCAGAGCATGAAGCATCGTATCTCGAGATACGATGCTTCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-999s1c1
Sequence:CCGGCCTCCACTTAACCAGCATGATCTCGAGATCATGCTGGTTAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-907s1c1
Sequence:CCGGCCTTCTGCAATAACACCTATTCTCGAGAATAGGTGTTATTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-3671s1c1
Sequence:CCGGCCCATTGAAGTGCCTCAAGAACTCGAGTTCTTGAGGCACTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172731
FGD5 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172731.2-4619s1c1
Sequence:CCGGGCTGTGTATCTAAGCACTTTACTCGAGTAAAGTGCTTAGATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-2918s1c1
Sequence:CCGGCCAGAGCATGAAGCATCGTATCTCGAGATACGATGCTTCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-999s1c1
Sequence:CCGGCCTCCACTTAACCAGCATGATCTCGAGATCATGCTGGTTAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-907s1c1
Sequence:CCGGCCTTCTGCAATAACACCTATTCTCGAGAATAGGTGTTATTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-3671s1c1
Sequence:CCGGCCCATTGAAGTGCCTCAAGAACTCGAGTTCTTGAGGCACTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172731
FGD5 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172731.2-4619s1c1
Sequence:CCGGGCTGTGTATCTAAGCACTTTACTCGAGTAAAGTGCTTAGATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-2918s1c1
Sequence:CCGGCCAGAGCATGAAGCATCGTATCTCGAGATACGATGCTTCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-999s1c1
Sequence:CCGGCCTCCACTTAACCAGCATGATCTCGAGATCATGCTGGTTAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-907s1c1
Sequence:CCGGCCTTCTGCAATAACACCTATTCTCGAGAATAGGTGTTATTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172731.2-3671s1c1
Sequence:CCGGCCCATTGAAGTGCCTCAAGAACTCGAGTTCTTGAGGCACTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks