EMAIL THIS PAGE TO A FRIEND

FGD6

FYVE, RhoGEF and PH domain containing 6

91 Gene Product Result for
Synonyms: ZFYVE24
UniProtKB ID: Q6ZV73, Q6ZR53, Q7Z2Z7, Q96D44, Q9NUR8, Q9P2I5
Gene ID:
Mouse(13998) FYVE, RhoGEF and PH domain containing 6
Rat(500824) FYVE, RhoGEF and PH domain containing 6
Zebrafish(556459) FYVE, RhoGEF and PH domain containing 6
chicken(417908) FYVE, RhoGEF and PH domain containing 6
cow(539481) FYVE, RhoGEF and PH domain containing 6
Horse(100065128) FYVE, RhoGEF and PH domain containing 6
domestic cat(101082166) FYVE, RhoGEF and PH domain containing 6
dog(482608) FYVE, RhoGEF and PH domain containing 6
naked mole-rat(101708057) FYVE, RhoGEF and PH domain containing 6
domestic guinea pig(100725950) FYVE, RhoGEF and PH domain containing 6
sheep(101116817) FYVE, RhoGEF and PH domain containing 6
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018351 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018351 Rosetta Predictions human pricing
XM_001080375 Rosetta Predictions rat pricing
XM_576214 Rosetta Predictions rat pricing
NM_053072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021684 predicted 4494
2 SASI_Hs01_00021685 predicted 878
3 SASI_Hs01_00021686 predicted 2481
4 SASI_Hs01_00021687 predicted 3347
5 SASI_Hs01_00021688 predicted 3990
6 SASI_Hs01_00021689 predicted 411
7 SASI_Hs02_00351806 predicted 314
8 SASI_Hs01_00021690 predicted 4227
9 SASI_Hs01_00021691 predicted 2305
10 SASI_Hs01_00021692 predicted 578
11 SASI_Hs01_00021693 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367780 predicted 3545
2 SASI_Rn02_00367781 predicted 1296
3 SASI_Rn02_00367782 predicted 1592
4 SASI_Rn02_00367783 predicted 500
5 SASI_Rn02_00367784 predicted 1835
6 SASI_Rn02_00367785 predicted 2113
7 SASI_Rn02_00367786 predicted 3392
8 SASI_Rn02_00367787 predicted 2372
9 SASI_Rn02_00367788 predicted 1058
10 SASI_Rn02_00367789 predicted 3571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404877 predicted 1304
2 SASI_Rn02_00404878 predicted 1598
3 SASI_Rn02_00404879 predicted 498
4 SASI_Rn02_00404880 predicted 1832
5 SASI_Rn02_00404881 predicted 285
6 SASI_Rn02_00404882 predicted 2105
7 SASI_Rn02_00404883 predicted 2371
8 SASI_Rn02_00404884 predicted 1062
9 SASI_Rn02_00404885 predicted 385
10 SASI_Rn02_00404886 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030857 predicted 3639
2 SASI_Mm01_00030859 predicted 1117
3 SASI_Mm01_00030862 predicted 1172
4 SASI_Mm01_00030863 predicted 1685
5 SASI_Mm01_00030864 predicted 1928
6 SASI_Mm01_00030865 predicted 4364
7 SASI_Mm01_00030866 predicted 1013
8 SASI_Mm02_00337539 predicted 3655
9 SASI_Mm02_00337540 predicted 1498
10 SASI_Mm02_00337541 predicted 4097
11 SASI_Mm01_00030858 predicted 1147
12 SASI_Mm01_00030860 predicted 674
13 SASI_Mm01_00030861 predicted 2078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018351
FGD6 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 6
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000420570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-1402s21c1
Sequence:CCGGATGCACAGGACTTAGTCAATTCTCGAGAATTGACTAAGTCCTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-665s21c1
Sequence:CCGGTGATGAGACTTTGACTATAAACTCGAGTTTATAGTCAAAGTCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-2502s21c1
Sequence:CCGGTACGAGAACTTGCCATTTATTCTCGAGAATAAATGGCAAGTTCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018351
FGD6 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 6
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000420570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-1402s21c1
Sequence:CCGGATGCACAGGACTTAGTCAATTCTCGAGAATTGACTAAGTCCTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-665s21c1
Sequence:CCGGTGATGAGACTTTGACTATAAACTCGAGTTTATAGTCAAAGTCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-2502s21c1
Sequence:CCGGTACGAGAACTTGCCATTTATTCTCGAGAATAAATGGCAAGTTCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018351
FGD6 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 6
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000420570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-1402s21c1
Sequence:CCGGATGCACAGGACTTAGTCAATTCTCGAGAATTGACTAAGTCCTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-665s21c1
Sequence:CCGGTGATGAGACTTTGACTATAAACTCGAGTTTATAGTCAAAGTCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018351.3-2502s21c1
Sequence:CCGGTACGAGAACTTGCCATTTATTCTCGAGAATAAATGGCAAGTTCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053072
VALIDATED
FGD6 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-517s21c1
Sequence:CCGGCCTACTTTGAACCTGGAGGAACTCGAGTTCCTCCAGGTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-3225s21c1
Sequence:CCGGCCTGAAGCACTACCTGCTAAACTCGAGTTTAGCAGGTAGTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-1981s21c1
Sequence:CCGGCGCGTCACTTTATCCTTAAATCTCGAGATTTAAGGATAAAGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053072.3-4896s21c1
Sequence:CCGGCCATACAGTGGTTGGTTATAACTCGAGTTATAACCAACCACTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-3642s21c1
Sequence:CCGGGGCATATCAGAACGAGTTAAACTCGAGTTTAACTCGTTCTGATATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-1161s1c1
Sequence:CCGGCGGTCCTTTAGAAATCCACTTCTCGAGAAGTGGATTTCTAAAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-4315s1c1
Sequence:CCGGGCTTTGGAAAGTCAGCCTTTACTCGAGTAAAGGCTGACTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-3222s1c1
Sequence:CCGGCCTGAAGCACTACCTGCTAAACTCGAGTTTAGCAGGTAGTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-517s1c1
Sequence:CCGGCCTACTTTGAACCTGGAGGAACTCGAGTTCCTCCAGGTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-1978s1c1
Sequence:CCGGCGCGTCACTTTATCCTTAAATCTCGAGATTTAAGGATAAAGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053072
VALIDATED
FGD6 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-517s21c1
Sequence:CCGGCCTACTTTGAACCTGGAGGAACTCGAGTTCCTCCAGGTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-3225s21c1
Sequence:CCGGCCTGAAGCACTACCTGCTAAACTCGAGTTTAGCAGGTAGTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-1981s21c1
Sequence:CCGGCGCGTCACTTTATCCTTAAATCTCGAGATTTAAGGATAAAGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053072.3-4896s21c1
Sequence:CCGGCCATACAGTGGTTGGTTATAACTCGAGTTATAACCAACCACTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-3642s21c1
Sequence:CCGGGGCATATCAGAACGAGTTAAACTCGAGTTTAACTCGTTCTGATATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-1161s1c1
Sequence:CCGGCGGTCCTTTAGAAATCCACTTCTCGAGAAGTGGATTTCTAAAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-4315s1c1
Sequence:CCGGGCTTTGGAAAGTCAGCCTTTACTCGAGTAAAGGCTGACTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-3222s1c1
Sequence:CCGGCCTGAAGCACTACCTGCTAAACTCGAGTTTAGCAGGTAGTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-517s1c1
Sequence:CCGGCCTACTTTGAACCTGGAGGAACTCGAGTTCCTCCAGGTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-1978s1c1
Sequence:CCGGCGCGTCACTTTATCCTTAAATCTCGAGATTTAAGGATAAAGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053072
VALIDATED
FGD6 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-517s21c1
Sequence:CCGGCCTACTTTGAACCTGGAGGAACTCGAGTTCCTCCAGGTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-3225s21c1
Sequence:CCGGCCTGAAGCACTACCTGCTAAACTCGAGTTTAGCAGGTAGTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-1981s21c1
Sequence:CCGGCGCGTCACTTTATCCTTAAATCTCGAGATTTAAGGATAAAGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053072.3-4896s21c1
Sequence:CCGGCCATACAGTGGTTGGTTATAACTCGAGTTATAACCAACCACTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053072.3-3642s21c1
Sequence:CCGGGGCATATCAGAACGAGTTAAACTCGAGTTTAACTCGTTCTGATATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-1161s1c1
Sequence:CCGGCGGTCCTTTAGAAATCCACTTCTCGAGAAGTGGATTTCTAAAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-4315s1c1
Sequence:CCGGGCTTTGGAAAGTCAGCCTTTACTCGAGTAAAGGCTGACTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-3222s1c1
Sequence:CCGGCCTGAAGCACTACCTGCTAAACTCGAGTTTAGCAGGTAGTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-517s1c1
Sequence:CCGGCCTACTTTGAACCTGGAGGAACTCGAGTTCCTCCAGGTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053072.2-1978s1c1
Sequence:CCGGCGCGTCACTTTATCCTTAAATCTCGAGATTTAAGGATAAAGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370702
VALIDATED
FGD6 MISSION shRNA Bacterial Glycerol Stock
FYVE, RhoGEF and PH domain containing 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370702.1-905s1c1
Sequence:CCGGCCCAAGTTTGTTGTGGCAAATCTCGAGATTTGCCACAACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-1216s1c1
Sequence:CCGGGCTGGGCCATAGAGAGAATTTCTCGAGAAATTCTCTCTATGGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-2625s1c1
Sequence:CCGGCGTCAAACAGTGAGCCTTCAACTCGAGTTGAAGGCTCACTGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370702.1-4086s1c1
Sequence:CCGGGCTTAAATGGACACCATGAAACTCGAGTTTCATGGTGTCCATTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-3605s1c1
Sequence:CCGGCGGATTCTAAATCAGATCCTACTCGAGTAGGATCTGATTTAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370702
VALIDATED
FGD6 MISSION shRNA shRNA Plasmid DNA
FYVE, RhoGEF and PH domain containing 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370702.1-905s1c1
Sequence:CCGGCCCAAGTTTGTTGTGGCAAATCTCGAGATTTGCCACAACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-1216s1c1
Sequence:CCGGGCTGGGCCATAGAGAGAATTTCTCGAGAAATTCTCTCTATGGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-2625s1c1
Sequence:CCGGCGTCAAACAGTGAGCCTTCAACTCGAGTTGAAGGCTCACTGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370702.1-4086s1c1
Sequence:CCGGGCTTAAATGGACACCATGAAACTCGAGTTTCATGGTGTCCATTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-3605s1c1
Sequence:CCGGCGGATTCTAAATCAGATCCTACTCGAGTAGGATCTGATTTAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370702
VALIDATED
FGD6 MISSION shRNA Lentiviral Transduction Particles
FYVE, RhoGEF and PH domain containing 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370702.1-905s1c1
Sequence:CCGGCCCAAGTTTGTTGTGGCAAATCTCGAGATTTGCCACAACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-1216s1c1
Sequence:CCGGGCTGGGCCATAGAGAGAATTTCTCGAGAAATTCTCTCTATGGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-2625s1c1
Sequence:CCGGCGTCAAACAGTGAGCCTTCAACTCGAGTTGAAGGCTCACTGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370702.1-4086s1c1
Sequence:CCGGGCTTAAATGGACACCATGAAACTCGAGTTTCATGGTGTCCATTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_370702.1-3605s1c1
Sequence:CCGGCGGATTCTAAATCAGATCCTACTCGAGTAGGATCTGATTTAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks