EMAIL THIS PAGE TO A FRIEND

FGF10

fibroblast growth factor 10

49 Gene Product Result for
UniProtKB ID: O15520, Q6FHT6, Q96P59
Gene ID:
Human(2255) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. Studies of the mouse homolog of suggested that this gene is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of lim bud formation. This gene is also implicated to be a primary factor in the process of wound healing. [provided by RefSeq, Jul 2008]
Mouse(14165) fibroblast growth factor 10
Rat(25443) fibroblast growth factor 10
chicken(395432) fibroblast growth factor 10
cow(326285) fibroblast growth factor 10
dog(612454) fibroblast growth factor 10
domestic cat(101090489) fibroblast growth factor 10
domestic guinea pig(100730085) fibroblast growth factor 10
naked mole-rat(101707578) fibroblast growth factor 10
sheep(443074) fibroblast growth factor 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004465 Rosetta Predictions human pricing
NM_012951 Rosetta Predictions rat pricing
NM_008002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216683 predicted 364
2 SASI_Hs01_00216684 predicted 376
3 SASI_Hs01_00216685 predicted 201
4 SASI_Hs01_00216686 predicted 375
5 SASI_Hs01_00216687 predicted 330
6 SASI_Hs01_00216688 predicted 234
7 SASI_Hs02_00337667 predicted 247
8 SASI_Hs01_00216689 predicted 225
9 SASI_Hs01_00216690 predicted 316
10 SASI_Hs02_00337668 predicted 381
11 SASI_Hs01_00216691 predicted 350
12 SASI_Hs01_00216692 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065320 predicted 399
2 SASI_Rn01_00065321 predicted 404
3 SASI_Rn01_00065322 predicted 405
4 SASI_Rn01_00065323 predicted 404
5 SASI_Rn01_00065324 predicted 403
6 SASI_Rn01_00065325 predicted 539
7 SASI_Rn01_00065326 predicted 395
8 SASI_Rn01_00065328 predicted 305
9 SASI_Rn01_00065329 predicted 489
10 SASI_Rn02_00260536 predicted 333
11 SASI_Rn01_00065327 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105293 predicted 542
2 SASI_Mm01_00105294 predicted 467
3 SASI_Mm01_00105295 predicted 733
4 SASI_Mm01_00105296 predicted 874
5 SASI_Mm01_00105297 predicted 984
6 SASI_Mm01_00105298 predicted 824
7 SASI_Mm01_00105299 predicted 984
8 SASI_Mm01_00105300 predicted 608
9 SASI_Mm01_00105301 predicted 556
10 SASI_Mm01_00105302 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004465
FGF10 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-305s21c1
Sequence:CCGGAGAAGGAGAACTGCCCGTACACTCGAGTGTACGGGCAGTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-433s21c1
Sequence:CCGGGAATTTAACAATGACTGTAAGCTCGAGCTTACAGTCATTGTTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-200s21c1
Sequence:CCGGTGCGGAGCTACAATCACCTTCCTCGAGGAAGGTGATTGTAGCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-523s21c1
Sequence:CCGGCAAATGTATGTGGCATTGAATCTCGAGATTCAATGCCACATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-332s1c1
Sequence:CCGGTGGAGATAACATCAGTAGAAACTCGAGTTTCTACTGATGTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-233s1c1
Sequence:CCGGGCTGGAGAAAGCTATTCTCTTCTCGAGAAGAGAATAGCTTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-381s1c1
Sequence:CCGGCAGCAACTATTACTTAGCCATCTCGAGATGGCTAAGTAATAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-243s1c1
Sequence:CCGGGCTATTCTCTTTCACCAAGTACTCGAGTACTTGGTGAAAGAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-264s1c1
Sequence:CCGGCTTTCTCAAGATTGAGAAGAACTCGAGTTCTTCTCAATCTTGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004465
FGF10 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-305s21c1
Sequence:CCGGAGAAGGAGAACTGCCCGTACACTCGAGTGTACGGGCAGTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-433s21c1
Sequence:CCGGGAATTTAACAATGACTGTAAGCTCGAGCTTACAGTCATTGTTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-200s21c1
Sequence:CCGGTGCGGAGCTACAATCACCTTCCTCGAGGAAGGTGATTGTAGCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-523s21c1
Sequence:CCGGCAAATGTATGTGGCATTGAATCTCGAGATTCAATGCCACATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-332s1c1
Sequence:CCGGTGGAGATAACATCAGTAGAAACTCGAGTTTCTACTGATGTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-233s1c1
Sequence:CCGGGCTGGAGAAAGCTATTCTCTTCTCGAGAAGAGAATAGCTTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-381s1c1
Sequence:CCGGCAGCAACTATTACTTAGCCATCTCGAGATGGCTAAGTAATAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-243s1c1
Sequence:CCGGGCTATTCTCTTTCACCAAGTACTCGAGTACTTGGTGAAAGAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-264s1c1
Sequence:CCGGCTTTCTCAAGATTGAGAAGAACTCGAGTTCTTCTCAATCTTGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004465
FGF10 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-305s21c1
Sequence:CCGGAGAAGGAGAACTGCCCGTACACTCGAGTGTACGGGCAGTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-433s21c1
Sequence:CCGGGAATTTAACAATGACTGTAAGCTCGAGCTTACAGTCATTGTTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-200s21c1
Sequence:CCGGTGCGGAGCTACAATCACCTTCCTCGAGGAAGGTGATTGTAGCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004465.1-523s21c1
Sequence:CCGGCAAATGTATGTGGCATTGAATCTCGAGATTCAATGCCACATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-332s1c1
Sequence:CCGGTGGAGATAACATCAGTAGAAACTCGAGTTTCTACTGATGTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-233s1c1
Sequence:CCGGGCTGGAGAAAGCTATTCTCTTCTCGAGAAGAGAATAGCTTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-381s1c1
Sequence:CCGGCAGCAACTATTACTTAGCCATCTCGAGATGGCTAAGTAATAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-243s1c1
Sequence:CCGGGCTATTCTCTTTCACCAAGTACTCGAGTACTTGGTGAAAGAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004465.1-264s1c1
Sequence:CCGGCTTTCTCAAGATTGAGAAGAACTCGAGTTCTTCTCAATCTTGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008002
FGF10 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008002.3-2502s1c1
Sequence:CCGGGCTCTGTAGATCACTAAATAACTCGAGTTATTTAGTGATCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-685s1c1
Sequence:CCGGTGGAGATAACATCAGTGGAAACTCGAGTTTCCACTGATGTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-876s1c1
Sequence:CCGGCAAATGTATGTGGCATTGAATCTCGAGATTCAATGCCACATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-737s1c1
Sequence:CCGGCAACTATTACTTAGCCATGAACTCGAGTTCATGGCTAAGTAATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-555s1c1
Sequence:CCGGCGGAGCTACAATCACCTCCAACTCGAGTTGGAGGTGATTGTAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008002
FGF10 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008002.3-2502s1c1
Sequence:CCGGGCTCTGTAGATCACTAAATAACTCGAGTTATTTAGTGATCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-685s1c1
Sequence:CCGGTGGAGATAACATCAGTGGAAACTCGAGTTTCCACTGATGTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-876s1c1
Sequence:CCGGCAAATGTATGTGGCATTGAATCTCGAGATTCAATGCCACATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-737s1c1
Sequence:CCGGCAACTATTACTTAGCCATGAACTCGAGTTCATGGCTAAGTAATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-555s1c1
Sequence:CCGGCGGAGCTACAATCACCTCCAACTCGAGTTGGAGGTGATTGTAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008002
FGF10 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008002.3-2502s1c1
Sequence:CCGGGCTCTGTAGATCACTAAATAACTCGAGTTATTTAGTGATCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-685s1c1
Sequence:CCGGTGGAGATAACATCAGTGGAAACTCGAGTTTCCACTGATGTTATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-876s1c1
Sequence:CCGGCAAATGTATGTGGCATTGAATCTCGAGATTCAATGCCACATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-737s1c1
Sequence:CCGGCAACTATTACTTAGCCATGAACTCGAGTTCATGGCTAAGTAATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008002.3-555s1c1
Sequence:CCGGCGGAGCTACAATCACCTCCAACTCGAGTTGGAGGTGATTGTAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks