EMAIL THIS PAGE TO A FRIEND

FGF11

fibroblast growth factor 11

Synonyms: FHF3
UniProtKB ID: Q92914, Q2YDX8
Gene ID:
Human(2256) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The function of this gene has not yet been determined. The expression pattern of the mouse homolog implies a role in nervous system development. [provided by RefSeq, Jul 2008]
Mouse(14166) fibroblast growth factor 11
Rat(170632) fibroblast growth factor 11
cow(613386) fibroblast growth factor 11
domestic cat(101097187) fibroblast growth factor 11
dog(607829) fibroblast growth factor 11
sheep(101122038) fibroblast growth factor 11
naked mole-rat(101724365) fibroblast growth factor 11
domestic guinea pig(100714378) fibroblast growth factor 11
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019281 MISSION® esiRNA esiRNA targeting human FGF11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004112 Rosetta Predictions human pricing
NM_130816 Rosetta Predictions rat pricing
NM_010198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239133 predicted 1337
2 SASI_Hs01_00239134 predicted 653
3 SASI_Hs01_00239135 predicted 1234
4 SASI_Hs01_00239136 predicted 757
5 SASI_Hs01_00239137 predicted 815
6 SASI_Hs01_00239138 predicted 1305
7 SASI_Hs01_00239139 predicted 672
8 SASI_Hs01_00239140 predicted 1304
9 SASI_Hs01_00239141 predicted 710
10 SASI_Hs01_00239142 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105038 predicted 355
2 SASI_Rn01_00105039 predicted 442
3 SASI_Rn02_00267508 predicted 232
4 SASI_Rn01_00105040 predicted 347
5 SASI_Rn01_00105041 predicted 359
6 SASI_Rn01_00105042 predicted 408
7 SASI_Rn02_00267509 predicted 230
8 SASI_Rn01_00105043 predicted 425
9 SASI_Rn01_00105044 predicted 202
10 SASI_Rn01_00105045 predicted 426
11 SASI_Rn01_00105046 predicted 230
12 SASI_Rn01_00105047 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145212 predicted 231
2 SASI_Mm01_00145213 predicted 433
3 SASI_Mm01_00145214 predicted 363
4 SASI_Mm01_00145215 predicted 343
5 SASI_Mm01_00145216 predicted 424
6 SASI_Mm01_00145217 predicted 242
7 SASI_Mm01_00145218 predicted 414
8 SASI_Mm01_00145219 predicted 207
9 SASI_Mm01_00145220 predicted 353
10 SASI_Mm01_00145221 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004112
VALIDATED
FGF11 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-1606s1c1
Sequence:CCGGCCACGGGTTTAACCTTCTTATCTCGAGATAAGAAGGTTAAACCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004112.2-647s1c1
Sequence:CCGGGCTCTACAGTTCGCCGCATTTCTCGAGAAATGCGGCGAACTGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-794s1c1
Sequence:CCGGCATGAAGGGAAACCGAGTTAACTCGAGTTAACTCGGTTTCCCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004112.2-533s1c1
Sequence:CCGGCCCAGAGGATACCAGCTCCTTCTCGAGAAGGAGCTGGTATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-701s1c1
Sequence:CCGGTGAGAATTACTACGTCCTGTACTCGAGTACAGGACGTAGTAATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004112
VALIDATED
FGF11 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-1606s1c1
Sequence:CCGGCCACGGGTTTAACCTTCTTATCTCGAGATAAGAAGGTTAAACCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004112.2-647s1c1
Sequence:CCGGGCTCTACAGTTCGCCGCATTTCTCGAGAAATGCGGCGAACTGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-794s1c1
Sequence:CCGGCATGAAGGGAAACCGAGTTAACTCGAGTTAACTCGGTTTCCCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004112.2-533s1c1
Sequence:CCGGCCCAGAGGATACCAGCTCCTTCTCGAGAAGGAGCTGGTATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-701s1c1
Sequence:CCGGTGAGAATTACTACGTCCTGTACTCGAGTACAGGACGTAGTAATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004112
VALIDATED
FGF11 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-1606s1c1
Sequence:CCGGCCACGGGTTTAACCTTCTTATCTCGAGATAAGAAGGTTAAACCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004112.2-647s1c1
Sequence:CCGGGCTCTACAGTTCGCCGCATTTCTCGAGAAATGCGGCGAACTGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-794s1c1
Sequence:CCGGCATGAAGGGAAACCGAGTTAACTCGAGTTAACTCGGTTTCCCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004112.2-533s1c1
Sequence:CCGGCCCAGAGGATACCAGCTCCTTCTCGAGAAGGAGCTGGTATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004112.2-701s1c1
Sequence:CCGGTGAGAATTACTACGTCCTGTACTCGAGTACAGGACGTAGTAATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010198
FGF11 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-430s1c1
Sequence:CCGGCGCTTTAAGGAGTGCGTCTTTCTCGAGAAAGACGCACTCCTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-300s1c1
Sequence:CCGGCTTCACCCACTTCAATCTGATCTCGAGATCAGATTGAAGTGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-451s1c1
Sequence:CCGGGAGAATTACTATGTCCTGTATCTCGAGATACAGGACATAGTAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-101s1c1
Sequence:CCGGGTACCAAGTCACTTTGCCAGACTCGAGTCTGGCAAAGTGACTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-207s1c1
Sequence:CCGGAGGCATCGTCACCAAACTGTTCTCGAGAACAGTTTGGTGACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010198
FGF11 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-430s1c1
Sequence:CCGGCGCTTTAAGGAGTGCGTCTTTCTCGAGAAAGACGCACTCCTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-300s1c1
Sequence:CCGGCTTCACCCACTTCAATCTGATCTCGAGATCAGATTGAAGTGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-451s1c1
Sequence:CCGGGAGAATTACTATGTCCTGTATCTCGAGATACAGGACATAGTAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-101s1c1
Sequence:CCGGGTACCAAGTCACTTTGCCAGACTCGAGTCTGGCAAAGTGACTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-207s1c1
Sequence:CCGGAGGCATCGTCACCAAACTGTTCTCGAGAACAGTTTGGTGACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010198
FGF11 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-430s1c1
Sequence:CCGGCGCTTTAAGGAGTGCGTCTTTCTCGAGAAAGACGCACTCCTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-300s1c1
Sequence:CCGGCTTCACCCACTTCAATCTGATCTCGAGATCAGATTGAAGTGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-451s1c1
Sequence:CCGGGAGAATTACTATGTCCTGTATCTCGAGATACAGGACATAGTAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-101s1c1
Sequence:CCGGGTACCAAGTCACTTTGCCAGACTCGAGTCTGGCAAAGTGACTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010198.1-207s1c1
Sequence:CCGGAGGCATCGTCACCAAACTGTTCTCGAGAACAGTTTGGTGACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks