EMAIL THIS PAGE TO A FRIEND

FGF12

fibroblast growth factor 12

176 Gene Product Result for
Synonyms: FGF12B FHF1
Gene ID:
Human(2257) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This growth factor lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, this protein accumulated in the nucleus, but was not secreted. The specific function of this gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(14167) fibroblast growth factor 12
Rat(170630) fibroblast growth factor 12
chicken(395704) fibroblast growth factor 12
cow(615823) fibroblast growth factor 12
domestic cat(101092457) fibroblast growth factor 12
dog(478676) fibroblast growth factor 12
domestic guinea pig(100733445) fibroblast growth factor 12
naked mole-rat(101702098) fibroblast growth factor 12
sheep(100302340) fibroblast growth factor 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004113 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004113 Rosetta Predictions human pricing
NM_021032 Rosetta Predictions human pricing
NM_130814 Rosetta Predictions rat pricing
NM_010199 Rosetta Predictions mouse pricing
NM_183064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017444 predicted 1057
2 SASI_Hs01_00017445 predicted 442
3 SASI_Hs01_00017446 predicted 521
4 SASI_Hs01_00017447 predicted 1043
5 SASI_Hs01_00017448 predicted 467
6 SASI_Hs01_00017451 predicted 409
7 SASI_Hs01_00017452 predicted 897
8 SASI_Hs01_00017453 predicted 420
9 SASI_Hs02_00336948 predicted 567
10 SASI_Hs02_00336949 predicted 1062
11 SASI_Hs01_00017449 predicted 561
12 SASI_Hs01_00017450 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118816 predicted 1006
2 SASI_Hs01_00118817 predicted 394
3 SASI_Hs01_00118818 predicted 483
4 SASI_Hs01_00118819 predicted 1001
5 SASI_Hs01_00118820 predicted 420
6 SASI_Hs01_00118822 predicted 697
7 SASI_Hs01_00118823 predicted 369
8 SASI_Hs01_00118824 predicted 376
9 SASI_Hs01_00118825 predicted 528
10 SASI_Hs02_00354507 predicted 520
11 SASI_Hs01_00118821 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101303 predicted 256
2 SASI_Rn02_00267507 predicted 358
3 SASI_Rn01_00101304 predicted 356
4 SASI_Rn01_00101305 predicted 366
5 SASI_Rn01_00101306 predicted 299
6 SASI_Rn01_00101307 predicted 202
7 SASI_Rn01_00101308 predicted 297
8 SASI_Rn01_00101310 predicted 239
9 SASI_Rn01_00101311 predicted 396
10 SASI_Rn01_00101312 predicted 255
11 SASI_Rn01_00101309 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182971 predicted 1014
2 SASI_Mm01_00182972 predicted 507
3 SASI_Mm01_00182973 predicted 507
4 SASI_Mm01_00182974 predicted 511
5 SASI_Mm01_00182975 predicted 1026
6 SASI_Mm01_00182976 predicted 495
7 SASI_Mm01_00182977 predicted 393
8 SASI_Mm01_00182978 predicted 480
9 SASI_Mm01_00182979 predicted 1069
10 SASI_Mm01_00182980 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186575 predicted 1055
2 SASI_Mm01_00186576 predicted 545
3 SASI_Mm01_00186577 predicted 543
4 SASI_Mm01_00186578 predicted 550
5 SASI_Mm01_00186579 predicted 1060
6 SASI_Mm01_00186580 predicted 529
7 SASI_Mm01_00186581 predicted 519
8 SASI_Mm01_00186582 predicted 1105
9 SASI_Mm01_00186583 predicted 1136
10 SASI_Mm01_00186584 predicted 1232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010199
FGF12 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-515s1c1
Sequence:CCGGGCATGGTTTCTAGGACTCAATCTCGAGATTGAGTCCTAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-689s1c1
Sequence:CCGGCCCACCATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-383s1c1
Sequence:CCGGGCCATGAATGGAGAAGGCTATCTCGAGATAGCCTTCTCCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-712s1c1
Sequence:CCGGCGTGAATCAAGATTCTACATACTCGAGTATGTAGAATCTTGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-314s1c1
Sequence:CCGGCTCTTCAATCTAATTCCTGTACTCGAGTACAGGAATTAGATTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010199
FGF12 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-515s1c1
Sequence:CCGGGCATGGTTTCTAGGACTCAATCTCGAGATTGAGTCCTAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-689s1c1
Sequence:CCGGCCCACCATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-383s1c1
Sequence:CCGGGCCATGAATGGAGAAGGCTATCTCGAGATAGCCTTCTCCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-712s1c1
Sequence:CCGGCGTGAATCAAGATTCTACATACTCGAGTATGTAGAATCTTGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-314s1c1
Sequence:CCGGCTCTTCAATCTAATTCCTGTACTCGAGTACAGGAATTAGATTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010199
FGF12 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-515s1c1
Sequence:CCGGGCATGGTTTCTAGGACTCAATCTCGAGATTGAGTCCTAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-689s1c1
Sequence:CCGGCCCACCATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-383s1c1
Sequence:CCGGGCCATGAATGGAGAAGGCTATCTCGAGATAGCCTTCTCCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-712s1c1
Sequence:CCGGCGTGAATCAAGATTCTACATACTCGAGTATGTAGAATCTTGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010199.1-314s1c1
Sequence:CCGGCTCTTCAATCTAATTCCTGTACTCGAGTACAGGAATTAGATTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004113
FGF12 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-426s1c1
Sequence:CCGGGCCATGAATGGTGAAGGCTATCTCGAGATAGCCTTCACCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-732s1c1
Sequence:CCGGCCAACCATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-558s1c1
Sequence:CCGGGCTTGGTTTCTGGGACTCAATCTCGAGATTGAGTCCCAGAAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-350s1c1
Sequence:CCGGCTACACTCTCTTCAATCTAATCTCGAGATTAGATTGAAGAGAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-571s1c1
Sequence:CCGGGACTCAATAAAGAAGGTCAAACTCGAGTTTGACCTTCTTTATTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004113.4-687s21c1
Sequence:CCGGAGAACCATCGCTACATGAAATCTCGAGATTTCATGTAGCGATGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004113.4-1177s21c1
Sequence:CCGGCTGATGTTATATACTCAATAGCTCGAGCTATTGAGTATATAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004113
FGF12 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-426s1c1
Sequence:CCGGGCCATGAATGGTGAAGGCTATCTCGAGATAGCCTTCACCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-732s1c1
Sequence:CCGGCCAACCATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-558s1c1
Sequence:CCGGGCTTGGTTTCTGGGACTCAATCTCGAGATTGAGTCCCAGAAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-350s1c1
Sequence:CCGGCTACACTCTCTTCAATCTAATCTCGAGATTAGATTGAAGAGAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-571s1c1
Sequence:CCGGGACTCAATAAAGAAGGTCAAACTCGAGTTTGACCTTCTTTATTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004113.4-687s21c1
Sequence:CCGGAGAACCATCGCTACATGAAATCTCGAGATTTCATGTAGCGATGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004113.4-1177s21c1
Sequence:CCGGCTGATGTTATATACTCAATAGCTCGAGCTATTGAGTATATAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004113
FGF12 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-426s1c1
Sequence:CCGGGCCATGAATGGTGAAGGCTATCTCGAGATAGCCTTCACCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-732s1c1
Sequence:CCGGCCAACCATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-558s1c1
Sequence:CCGGGCTTGGTTTCTGGGACTCAATCTCGAGATTGAGTCCCAGAAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-350s1c1
Sequence:CCGGCTACACTCTCTTCAATCTAATCTCGAGATTAGATTGAAGAGAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004113.3-571s1c1
Sequence:CCGGGACTCAATAAAGAAGGTCAAACTCGAGTTTGACCTTCTTTATTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004113.4-687s21c1
Sequence:CCGGAGAACCATCGCTACATGAAATCTCGAGATTTCATGTAGCGATGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004113.4-1177s21c1
Sequence:CCGGCTGATGTTATATACTCAATAGCTCGAGCTATTGAGTATATAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks