EMAIL THIS PAGE TO A FRIEND

FGF13

fibroblast growth factor 13

180 Gene Product Result for
Synonyms: FGF-13 FGF2 FHF-2 FHF2
Gene ID:
Human(2258) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located in a region on chromosome X, which is associated with Borjeson-Forssman-Lehmann syndrome (BFLS), making it a possible candidate gene for familial cases of the BFLS, and for other syndromal and nonspecific forms of X-linked mental retardation mapping to this region. Alternative splicing of this gene at the 5' end results in several transcript variants encoding different isoforms with different N-termini. [provided by RefSeq, Nov 2008]
Mouse(14168) fibroblast growth factor 13
Rat(84488) fibroblast growth factor 13
chicken(414831) fibroblast growth factor 13
dog(492174) fibroblast growth factor 13
domestic cat(101099535) fibroblast growth factor 13
cow(506924) fibroblast growth factor 13
sheep(101101956) fibroblast growth factor 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502138 Anti-FGF13 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, pig, bovine, canine
ELISA, western blot pricing
SAB1405809 Anti-FGF13 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA002809 Anti-FGF13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1401138 Anti-FGF13 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103570 Anti-FGF13 antibody produced in rabbit affinity isolated antibody canine, mouse, sheep, bovine, rat, guinea pig, horse, rabbit, zebrafish, human
western blot pricing
SAB5201230 Monoclonal Anti-Fgfa/Fhfa (Pan) antibody produced in mouse clone S235-22, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201239 Monoclonal Anti-Fgfa/Fhfa - Alkaline Phosphatase antibody produced in mouse clone S235-22, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201240 Monoclonal Anti-Fgfa/Fhfa - Apc antibody produced in mouse clone S235-22, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201231 Monoclonal Anti-Fgfa/Fhfa - Atto 390 antibody produced in mouse clone S235-22, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201232 Monoclonal Anti-Fgfa/Fhfa - Atto 488 antibody produced in mouse clone S235-22, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201233 Monoclonal Anti-Fgfa/Fhfa - Atto 565 antibody produced in mouse clone S235-22, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201234 Monoclonal Anti-Fgfa/Fhfa - Atto 594 antibody produced in mouse clone S235-22, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201235 Monoclonal Anti-Fgfa/Fhfa - Atto 633 antibody produced in mouse clone S235-22, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201236 Monoclonal Anti-Fgfa/Fhfa - Atto 655 antibody produced in mouse clone S235-22, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201237 Monoclonal Anti-Fgfa/Fhfa - Atto 680 antibody produced in mouse clone S235-22, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201238 Monoclonal Anti-Fgfa/Fhfa - Atto 700 antibody produced in mouse clone S235-22, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201241 Monoclonal Anti-Fgfa/Fhfa - Biotin antibody produced in mouse clone S235-22, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201242 Monoclonal Anti-Fgfa/Fhfa - Fitc antibody produced in mouse clone S235-22, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201243 Monoclonal Anti-Fgfa/Fhfa - Hrp antibody produced in mouse clone S235-22, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201244 Monoclonal Anti-Fgfa/Fhfa - Pe/Atto 594 antibody produced in mouse clone S235-22, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201245 Monoclonal Anti-Fgfa/Fhfa - Percp antibody produced in mouse clone S235-22, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201246 Monoclonal Anti-Fgfa/Fhfa - Rpe antibody produced in mouse clone S235-22, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201247 Monoclonal Anti-Fgfa/Fhfa - Streptavidin antibody produced in mouse clone S235-22, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004114 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022191 MISSION® esiRNA esiRNA targeting mouse Fgf13 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004114 Rosetta Predictions human pricing
NM_033642 Rosetta Predictions human pricing
NM_053428 Rosetta Predictions rat pricing
NM_010200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225685 predicted 1443
2 SASI_Hs01_00225686 predicted 1113
3 SASI_Hs01_00225687 predicted 1429
4 SASI_Hs01_00225689 predicted 1244
5 SASI_Hs01_00225690 predicted 1261
6 SASI_Hs01_00225691 predicted 1067
7 SASI_Hs02_00336950 predicted 1087
8 SASI_Hs01_00225692 predicted 1377
9 SASI_Hs01_00225693 predicted 1142
10 SASI_Hs01_00225694 predicted 1439
11 SASI_Hs01_00225688 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124002 predicted 711
2 SASI_Hs01_00124003 predicted 383
3 SASI_Hs01_00124004 predicted 693
4 SASI_Hs01_00124006 predicted 512
5 SASI_Hs01_00124007 predicted 528
6 SASI_Hs01_00124008 predicted 332
7 SASI_Hs02_00361454 predicted 345
8 SASI_Hs01_00124009 predicted 643
9 SASI_Hs01_00124010 predicted 414
10 SASI_Hs01_00124011 predicted 703
11 SASI_Hs01_00124005 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105753 predicted 252
2 SASI_Rn01_00105754 predicted 783
3 SASI_Rn01_00105755 predicted 751
4 SASI_Rn01_00105756 predicted 248
5 SASI_Rn01_00105757 predicted 489
6 SASI_Rn01_00105758 predicted 332
7 SASI_Rn01_00105759 predicted 765
8 SASI_Rn01_00105760 predicted 721
9 SASI_Rn01_00105762 predicted 556
10 SASI_Rn02_00265980 predicted 385
11 SASI_Rn01_00105761 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059070 predicted 656
2 SASI_Mm01_00059071 predicted 899
3 SASI_Mm01_00059072 predicted 734
4 SASI_Mm01_00059073 predicted 560
5 SASI_Mm01_00059074 predicted 1159
6 SASI_Mm01_00059075 predicted 870
7 SASI_Mm01_00059076 predicted 1126
8 SASI_Mm01_00059077 predicted 960
9 SASI_Mm01_00059078 predicted 574
10 SASI_Mm02_00318007 predicted 1095
11 SASI_Mm01_00059079 predicted 730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004114
FGF13 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004114.3-1583s21c1
Sequence:CCGGTAGATTGAGCTTGTGCATAAGCTCGAGCTTATGCACAAGCTCAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004114.3-1223s21c1
Sequence:CCGGGAACAAGCCTGCAGCTCATTTCTCGAGAAATGAGCTGCAGGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1376s1c1
Sequence:CCGGGAGCCACAATGAATCAACGTACTCGAGTACGTTGATTCATTGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1016s1c1
Sequence:CCGGCAAGCTGTACTTGGCAATGAACTCGAGTTCATTGCCAAGTACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1191s1c1
Sequence:CCGGGAGATCATGAAAGGCAACCATCTCGAGATGGTTGCCTTTCATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-859s1c1
Sequence:CCGGAGGGTATAGTTACCAAGCTATCTCGAGATAGCTTGGTAACTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-947s1c1
Sequence:CCGGCAGCACTTACACTCTGTTTAACTCGAGTTAAACAGAGTGTAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004114
FGF13 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004114.3-1583s21c1
Sequence:CCGGTAGATTGAGCTTGTGCATAAGCTCGAGCTTATGCACAAGCTCAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004114.3-1223s21c1
Sequence:CCGGGAACAAGCCTGCAGCTCATTTCTCGAGAAATGAGCTGCAGGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1376s1c1
Sequence:CCGGGAGCCACAATGAATCAACGTACTCGAGTACGTTGATTCATTGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1016s1c1
Sequence:CCGGCAAGCTGTACTTGGCAATGAACTCGAGTTCATTGCCAAGTACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1191s1c1
Sequence:CCGGGAGATCATGAAAGGCAACCATCTCGAGATGGTTGCCTTTCATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-859s1c1
Sequence:CCGGAGGGTATAGTTACCAAGCTATCTCGAGATAGCTTGGTAACTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-947s1c1
Sequence:CCGGCAGCACTTACACTCTGTTTAACTCGAGTTAAACAGAGTGTAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004114
FGF13 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004114.3-1583s21c1
Sequence:CCGGTAGATTGAGCTTGTGCATAAGCTCGAGCTTATGCACAAGCTCAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004114.3-1223s21c1
Sequence:CCGGGAACAAGCCTGCAGCTCATTTCTCGAGAAATGAGCTGCAGGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1376s1c1
Sequence:CCGGGAGCCACAATGAATCAACGTACTCGAGTACGTTGATTCATTGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1016s1c1
Sequence:CCGGCAAGCTGTACTTGGCAATGAACTCGAGTTCATTGCCAAGTACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-1191s1c1
Sequence:CCGGGAGATCATGAAAGGCAACCATCTCGAGATGGTTGCCTTTCATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-859s1c1
Sequence:CCGGAGGGTATAGTTACCAAGCTATCTCGAGATAGCTTGGTAACTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004114.2-947s1c1
Sequence:CCGGCAGCACTTACACTCTGTTTAACTCGAGTTAAACAGAGTGTAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010200
FGF13 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-829s1c1
Sequence:CCGGCGTGACATACTCATCAATGATCTCGAGATCATTGATGAGTATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-659s1c1
Sequence:CCGGGACAGCACTTACACTCTGTTTCTCGAGAAACAGAGTGTAAGTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-563s1c1
Sequence:CCGGCCTCAGCTTAAGGGTATAGTTCTCGAGAACTATACCCTTAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-708s1c1
Sequence:CCGGTGGCTATTCAAGGAGTTCAAACTCGAGTTTGAACTCCTTGAATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-1065s1c1
Sequence:CCGGGTGTACTGAATGGAGGCAAATCTCGAGATTTGCCTCCATTCAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010200
FGF13 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-829s1c1
Sequence:CCGGCGTGACATACTCATCAATGATCTCGAGATCATTGATGAGTATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-659s1c1
Sequence:CCGGGACAGCACTTACACTCTGTTTCTCGAGAAACAGAGTGTAAGTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-563s1c1
Sequence:CCGGCCTCAGCTTAAGGGTATAGTTCTCGAGAACTATACCCTTAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-708s1c1
Sequence:CCGGTGGCTATTCAAGGAGTTCAAACTCGAGTTTGAACTCCTTGAATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-1065s1c1
Sequence:CCGGGTGTACTGAATGGAGGCAAATCTCGAGATTTGCCTCCATTCAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010200
FGF13 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-829s1c1
Sequence:CCGGCGTGACATACTCATCAATGATCTCGAGATCATTGATGAGTATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-659s1c1
Sequence:CCGGGACAGCACTTACACTCTGTTTCTCGAGAAACAGAGTGTAAGTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-563s1c1
Sequence:CCGGCCTCAGCTTAAGGGTATAGTTCTCGAGAACTATACCCTTAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-708s1c1
Sequence:CCGGTGGCTATTCAAGGAGTTCAAACTCGAGTTTGAACTCCTTGAATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010200.2-1065s1c1
Sequence:CCGGGTGTACTGAATGGAGGCAAATCTCGAGATTTGCCTCCATTCAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks